Information on EC 6.5.1.1 - DNA ligase (ATP)

New: Word Map on EC 6.5.1.1
Please wait a moment until all data is loaded. This message will disappear when all data is loaded.
Specify your search results
Mark a special word or phrase in this record:
Select one or more organisms in this record:
Show additional data
Do not include text mining results
Include (text mining) results (more...)
Include results (AMENDA + additional results, but less precise; more...)

The enzyme appears in viruses and cellular organisms

EC NUMBER
COMMENTARY
6.5.1.1
-
RECOMMENDED NAME
GeneOntology No.
DNA ligase (ATP)
REACTION
REACTION DIAGRAM
COMMENTARY
ORGANISM
UNIPROT
LITERATURE
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m = AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m = AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
initial step in DNA ligation is the formation of a covalent enzyme-adenylate intermediate
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m = AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
uni-uni uni-bi ping-pong mechanism. The order of substrate addition and product release is as follows: ATP, diphosphate, nicked DNA, sealed DNA, 5'-AMP
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m = AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
mechanism: 1. formation of a covalent enzyme-adenylate complex, the ATP is cleaved to AMP and diphosphate with adenylyl residue linked by a phosphoramidate bond to the epsilon-amino group of a specific lysine residue at the active site of the protein, 2. the activated AMP residue of the DNA ligase-adenylate intermediate is transferred to the 5'-phosphate terminus of a single strand break in double-stranded DNA to generate a covalent DNA-AMP complex with a 5'-5' phosphoanhydride bond, 3. in the final step of DNA ligation, unadenylated DNA ligase is required for the generation of a phosphodiester bond and catalyzes displacement of the AMP residue through attack by adjacent 3'-hydroxyl group of the adenylylated site
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m = AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
joining of single-stranded breaks in duplex DNA
-
-
-
REACTION TYPE
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
esterification
-
-
phosphodiester
-
SYSTEMATIC NAME
IUBMB Comments
Poly(deoxyribonucleotide):poly(deoxyribonucleotide) ligase (AMP-forming)
Catalyses the formation of a phosphodiester at the site of a single-strand break in duplex DNA. RNA can also act as substrate, to some extent.
SYNONYMS
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
adenosine triphosphate-dependent ligase
-
-
APE1094
Q9YD18
gene name
APE1094
Aeropyrum pernix DSM 11879
Q9YD18
gene name; gene name
-
ApeLig
Q9YD18
-
ApeLig
Aeropyrum pernix DSM 11879
Q9YD18
-
-
ATP-dependent DNA ligase
O29632
-
ATP-dependent DNA ligase
-
-
ATP-dependent DNA ligase
-
-
ATP-dependent DNA ligase
-
-
-
ATP-dependent DNA ligase
-
-
ATP-dependent DNA ligase
-
-
ATP-dependent DNA ligase
-
-
ATP-dependent DNA ligase
-
-
ATP-dependent DNA ligase
-
-
ATP-dependent DNA ligase
-
-
ATP-dependent DNA ligase
-
-
ATP-dependent DNA ligase
-
-
ATP-dependent DNA ligase
-
-
ATP-dependent DNA ligase
-
-
ATP-dependent DNA ligase
-
-
ATP-dependent DNA ligase
-
-
ATP-dependent DNA ligase
-
-
ATP-dependent DNA ligase
-
-
ATP-dependent DNA ligase
C0LJI8
-
ATP-dependent DNA ligase
C0LJI8
-
-
ATP-dependent DNA ligase
-
-
ATP-dependent DNA ligase
-
-
ATP-dependent DNA ligase
-
-
ATP-dependent DNA ligase
Vaccinia virus, Vibrio phage, Xanthomonas phage, Xylanimonas cellulosilytica DSM 15894
-
-
ATP-dependent DNA ligase I
-
-
ATP-dependent ligase
-
-
ATP-dependent ligase LigB
-
-
ATP-dependent ligase LigC
-
-
ATP-dependent ligase LigD
-
-
ATP-type DNA repair ligase
-
-
ChVLig
Paramecium bursaria chlorella virus
O41026
-
Deoxyribonucleate ligase
-
-
-
-
Deoxyribonucleic acid joinase
-
-
-
-
Deoxyribonucleic acid ligase
-
-
-
-
Deoxyribonucleic acid repair enzyme
-
-
-
-
Deoxyribonucleic acid-joining enzyme
-
-
-
-
Deoxyribonucleic joinase
-
-
-
-
Deoxyribonucleic ligase
-
-
-
-
Deoxyribonucleic repair enzyme
-
-
-
-
Deoxyribonucleic-joining enzyme
-
-
-
-
DNA joinase
-
-
-
-
DNA ligase
-
-
-
-
DNA ligase
-
-
DNA ligase
Q2PCE4
-
DNA ligase
Ferroplasma acidiphilum YT
Q2PCE4
-
-
DNA ligase
-
-
DNA ligase
-
-
DNA ligase
Paramecium bursaria chlorella virus
O41026
-
DNA ligase
-
-
DNA ligase
P56709
-
DNA ligase
-
-
DNA ligase
C0LJI8
-
DNA ligase
C0LJI8
;
-
DNA ligase 1
-
-
DNA ligase 4
P49917
-
DNA ligase 4
-
-
DNA ligase I
-
-
-
-
DNA ligase I
-
-
DNA ligase I
C4M5H3
-
DNA ligase I
Entamoeba histolytica HM1:IMSS
C4M5H3
-
-
DNA ligase I
-
-
DNA ligase I
-
DNA ligase I is required for 10bp-microhomology-mediated end joining
DNA ligase I
-
-
DNA ligase I
Q976G4
-
DNA ligase I
Sulfolobus tokodaii 7
Q976G4
-
-
DNA ligase II
-
-
-
-
DNA ligase II
-
-
DNA ligase III
-
-
-
-
DNA ligase III
-
-
DNA ligase III
-
-
DNA ligase III
-
DNA ligase III is required in microhomology-mediated end joining
DNA ligase III
P49916
-
DNA ligase III
-
-
DNA ligase IIIalpha
-
-
DNA ligase IV
-
DNA ligase IV is not required in microhomology-mediated end joining but facilitates Ku-dependent nonhomologous end-joining
DNA ligase IV
P49917
-
DNA ligase IV
-
-
DNA ligase IV homolog
-
-
-
-
DNA ligase IV-XRCC4 complex
-
-
DNA ligase IV/XRCC4 complex
-
plays a central role in DNA double-strand break repair by non-homologous end joining
DNA ligase IV/XRCC4/XLF complex
-
-
DNA ligase V
-
-
DNA ligase VI
F4HPZ9
-
DNA repair enzyme
-
-
-
-
DNA-joining enzyme
-
-
-
-
DNAligI
C4M5H3
-
DNAligI
Entamoeba histolytica HM1:IMSS
C4M5H3
-
-
drB0100
-
gene name
Hbu DNA ligase
-
-
Hbu DNA ligase
Hyperthermus butylicus DSMZ 5456
-
-
-
L3BRCT
P49916
C-terminal ligase III-alpha BRCT domain
LdMNPV DNA ligase
Lymantria dispar multicapsid nucleopolyhedrovirus
Q9YMV2
-
Lig
Ferroplasma acidiphilum YT
Q2PCE4
-
-
Lig I
-
-
Lig III
-
-
LIG k alpha
-
-
Lig K protein
Q53E05
-
Lig(Tk)
-
-
-
-
Lig3
-
-
Lig3alpha
-
-
Lig4
-
Lig4 is involved in, but not essential for, the non-homologous end-joining system in Magnaporthe grisea
Lig4
-
-
LigA
-
-
ligase III
-
-
ligase III-alpha
P49916
-
LigD
-
LigD is a large multifunctional enzyme consisting of an ATP-dependent ligase domain, a polymerase domain, and a 3'-phosphoesterase domain
LigIII
-
-
LigTh1519
C0LJI8
-
LigTh1519
C0LJI8
;
-
MJ0171
Q57635
locus name
NHEJ DNA repair ligase
-
-
PBCV-1 DNA ligase
-
-
PF1635
P56709
locus name
Pfu DNA ligase
-
-
-
-
Polydeoxyribonucleotide synthase (ATP)
-
-
-
-
Polydeoxyribonucleotide synthase [ATP]
-
-
-
-
Polynucleotide ligase
-
-
-
-
Sealase
-
-
-
-
ssLig
Q980T8
-
-
SSO0189
Q980T8
locus name
SSO0189
Q980T8
locus name
-
T4 ATP ligase
-
-
Vaccinia ligase
-
-
X4L4
-
-
XRCC1/DNA ligase III
-
-
XRCC4-DNA ligase IV complex
-
the X4L4 complex contains two subunits of XRCC4 and one subunit of ligase IV
CAS REGISTRY NUMBER
COMMENTARY
9015-85-4
-
ORGANISM
COMMENTARY
LITERATURE
UNIPROT
SEQUENCE DB
SOURCE
the ApeLig gene is originally annotated as a protein of 619 amino acids, with a calculated mass of 69196.2 Da. Later it was reannotated as a protein of 602 amino acids (67747.6 Da), in which 17 amino acids are truncated from the N-terminus of the originally annotated protein. The UniProt-number refers to the 602 amino acid protein
SwissProt
Manually annotated by BRENDA team
Aeropyrum pernix DSM 11879
the ApeLig gene is originally annotated as a protein of 619 amino acids, with a calculated mass of 69196.2 Da. Later it was reannotated as a protein of 602 amino acids (67747.6 Da), in which 17 amino acids are truncated from the N-terminus of the originally annotated protein. The UniProt-number refers to the 602 amino acid protein
SwissProt
Manually annotated by BRENDA team
expressed in Escherichia coli
-
-
Manually annotated by BRENDA team
ecotype Col-0
UniProt
Manually annotated by BRENDA team
; indication, that DNA ligase II from bovine liver is derived from DNA ligase IIIalpha by proteolysis
-
-
Manually annotated by BRENDA team
calf; DNA ligase I
-
-
Manually annotated by BRENDA team
calf; DNA ligase I, II
-
-
Manually annotated by BRENDA team
calf; DNA ligase I, II, III
-
-
Manually annotated by BRENDA team
DNA ligase II
-
-
Manually annotated by BRENDA team
ligase I and II
-
-
Manually annotated by BRENDA team
strain Ellin428
-
-
Manually annotated by BRENDA team
DNA ligase I and II
-
-
Manually annotated by BRENDA team
Entamoeba histolytica HM1:IMSS
-
UniProt
Manually annotated by BRENDA team
Enterobacteria phage
-
-
-
Manually annotated by BRENDA team
Erwinia phage
-
-
-
Manually annotated by BRENDA team
-
-
-
Manually annotated by BRENDA team
strain YT DSM12658
UniProt
Manually annotated by BRENDA team
Ferroplasma acidiphilum YT
strain YT DSM12658
UniProt
Manually annotated by BRENDA team
-
SwissProt
Manually annotated by BRENDA team
2-3fold increase in DNA ligase I protein levels after 1 day exposure of MiaPaCa cells to 0.000015-0.00024 mM 2',2'-difluoro-2'-deoxycytidine
-
-
Manually annotated by BRENDA team
3fold increase in DNA ligase I protein levels after exposure of MiaPa cells to 1-beta-arabinosylcytosine, DNA ligase I is also induced by aphidicolin
-
-
Manually annotated by BRENDA team
DNA ligase III and IV
-
-
Manually annotated by BRENDA team
DNA ligase IV
-
-
Manually annotated by BRENDA team
Lymantria dispar multicapsid nucleopolyhedrovirus
most probably a type III DNA ligase
SwissProt
Manually annotated by BRENDA team
strains Guy11 and P2
Uniprot
Manually annotated by BRENDA team
DNA ligase I, II, and III
-
-
Manually annotated by BRENDA team
DNA ligase I, II, III-alpha, III-beta, and IV. DNA ligase II appears to be derived from DNA ligase III by a proteolytic mechanism
-
-
Manually annotated by BRENDA team
DNA ligase I and II
-
-
Manually annotated by BRENDA team
ATP-dependent ligase LigB; ATP-dependent ligase LigC; ATP-dependent ligase LigD
-
-
Manually annotated by BRENDA team
Paramecium bursaria chlorella virus
-
UniProt
Manually annotated by BRENDA team
Pleurodeles sp.
-
-
-
Manually annotated by BRENDA team
a novel enzyme form different from DNA ligase I
-
-
Manually annotated by BRENDA team
DNA ligase I and II
-
-
Manually annotated by BRENDA team
DNA ligase I and III
-
-
Manually annotated by BRENDA team
DNA ligase III
-
-
Manually annotated by BRENDA team
DNA ligase I
-
-
Manually annotated by BRENDA team
inactivation of DNL4 gene causes temperature-sensitive growth
SwissProt
Manually annotated by BRENDA team
strain 7
UniProt
Manually annotated by BRENDA team
Sulfolobus tokodaii 7
strain 7
UniProt
Manually annotated by BRENDA team
strain 1519
UniProt
Manually annotated by BRENDA team
acidophilic archaebacterium JP2 from geothermally active sites in Papua New Guinea
-
-
Manually annotated by BRENDA team
Vibrio phage
-
-
-
Manually annotated by BRENDA team
Xanthomonas phage
-
-
-
Manually annotated by BRENDA team
GENERAL INFORMATION
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
malfunction
-
DNA ligase I deficiency leads to replication-dependent DNA damage and impacts cell morphology without blocking cell cycle progression. LigI deficiency affects the maturation of nascent DNA and increases the frequency of gammaH2AX foci throughout the cell cycle. LigI deficiency leads to chronic activation of the ataxia telangiectasia mutated-mediated DNA damage checkpoint
malfunction
-
DNA ligase IV deficiency syndrome (LIG4 syndrome) is a rare autosomal recessive disorder characterized by microcephaly, growth retardation, low birth weight, dysmorphic facial findings, immunodeficiency, pancytopenia, and radiosensitivity due to impaired repair of DNA double-strand breaks by non-homologous end-joining
malfunction
-
knockout mutants of lig1 are lethal. lig1-RNAi lines with reduced levels of LIG1 display slower repair of single strand breaks and also double strand breaks
malfunction
-
Lig1-deficient 46BR.1G1 cells are hypomutable by DNA damage
malfunction
-
a drB0100 gene deletion mutant exhibits a nearly 2-log cycle reduction in growth rate when exposed to a 10000 Gray dose of gamma-radiation and a significant loss in mitomycin C and methylmethane sulfonate tolerance as compared to the wild type
malfunction
F4HPZ9
Arabidopsis atlig6 and lig6/lig4 mutants display significant hypersensitivity to controlled seed ageing, resulting in delayed germination and reduced seed viability relative to wild type lines, and display increased sensitivity to low-temperature stress, resulting in delayed germination and reduced seedling vigour upon transfer to standard growth conditions
malfunction
-
deletion of Lig3 results in cellular lethality. Translocations are reduced in frequency in the absence of Lig3. alternative nonhomologous end-joining is impaired with Lig3 loss. Deletion of the zinc finger domain of Lig3, but not the XRCC1-interacting BRCT domain, affects translocation frequency and outcome
malfunction
-
disruption of MSH-1 results directly in resistance to monensin, salinomycin, and methylnitrourea
malfunction
-
inactivation of Lig3 in the mouse nervous system results in mitochondrial DNA loss leading to profound mitochondrial dysfunction, disruption of cellular homeostasis and incapacitating ataxia. Lig3 inactivation causes cardiac failure associated with defective mitochondrial function
malfunction
-
Lig4 deficiency restores gene conversion to PARP-1-deficient cells
malfunction
-
loss of Lig3 is not associated with sensitivity to several DNA-damaging agents or with increased sister-chromatid exchange
malfunction
-
loss-of-function of LIG1 in Arabidopsis thaliana causes maternal effects in the endosperm
malfunction
-
DNA ligase III knockdown attenuates the recovery of mtDNA copy number and causes single strand nicks in replicating mtDNA molecules, suggesting the involvement of DNA ligase III in Okazaki fragment ligation in human mitochondria
malfunction
-
the level of CTG instability in transgenic DM1 mice with more than 300 CTG repeats which are crossed to mice carrying the homozygous 46BR LigI mutation (only 3% normal activity) and in vitro replication of CTG DNA templates by protein extracts from the 46BR.1G1 LIGI-deficient cell line is assessed. The 46BR LigI enhances CTG contractions in maternal transmissions but not paternal transmissions or somatic tissues. The presence of CTG contractions in oocytes and a replication template-specific effect of the 46BR LigI support a role for LigI in maternal allele-specific CTG instability
malfunction
-
using chicken B-cell line DT40 and a conditional knockout strategy is shown that LIG3, but not LIG1 or LIG4, is essential for DT40 survival
physiological function
-
cellular DNA ligase I is recruited to cytoplasmic vaccinia virus factories and masks the role of the vaccinia ligase in viral DNA replication
physiological function
-
human DNA ligase I is considered the main replicative ligase and plays an important role in the joining of Okazaki fragments during lagging strand synthesis
physiological function
-
LIG1 is involved in repair of of single strand breaks and double strand breaks
physiological function
-
protein Ku and DNA ligase D are the central agents of the bacterial nonhomologous end joining pathway of DNA double strand break repair
physiological function
-
the XRCC4/DNA ligase IV complex catalyzes the final ligation step in nonhomologous end-joining
physiological function
-
besides repairing nuclear DNA, ligase III is the only mitochondrial DNA ligase in which it functions in DNA repair and replication
physiological function
-
DNA ligase 4 stabilizes the ribosomal DNA array upon fork collapse at the replication fork barrier
physiological function
-
DNA ligase III 3 is a key ligase during base excision repair. DNA ligase III is critical for mitochondrial DNA integrity but not Xrcc1-mediated nuclear DNA repair
physiological function
C4M5H3
DNAligI is involved in sealing DNA nicks during lagging strand synthesis and may have a role in base excision repair in Entamoeba histolytica
physiological function
-
Lig3 promotes alternative nonhomologous end-joining during chromosomal translocation formation. Lig3 is essential for mitochondrial DNA metabolism
physiological function
F4HPZ9
LIG6 is required for rapid seed germination and a major determinant of Arabidopsis seed quality and longevity. LIG6 is not essential for the replication of nuclear or organellar genomes. LIG6 has roles in repairing DNA damage accumulated during seed development, storage and/or imbibitions. Lig6 is important for germination vigour under cold temperature stress and for germination under oxidative stress
physiological function
-
monensin activates an MSH-1-dependent cell cycle checkpoint ultimately leading to the death of the parasite
physiological function
-
the LigB operon components contribute to radiation resistance and double-strand break repair in Deinococcus radiodurans
physiological function
-
the mitochondrial, but not nuclear, Lig3 is required for cellular viability
physiological function
-
DNA ligases seal single-strand breaks in double-stranded DNA and their function is essential to maintain the integrity of the genome during various aspects of DNA metabolism, such as replication, excision repair and recombination. DNA-strand breaks are frequently generated as reaction intermediates in these events and the sealing of these breaks depends solely on the proper function of DNA ligase
physiological function
-
LigIII functions as the primary ligase in DNA replication in the absence of LigI. A functional redundancy between LigI and LigIII in DNA replication is indicated
physiological function
-
using chicken B-cell system DT40 and conditioned knockout strategies it is shown that LIG1 and LIG3 are able to support double-strand break (DSB) repair by backup non-homologous end joining (B-NHEJ) with similar activity in interchangeable manner
physiological function
Entamoeba histolytica HM1:IMSS
-
DNAligI is involved in sealing DNA nicks during lagging strand synthesis and may have a role in base excision repair in Entamoeba histolytica
-
SUBSTRATE
PRODUCT                      
REACTION DIAGRAM
ORGANISM
UNIPROT
COMMENTARY
(Substrate)
LITERATURE
(Substrate)
COMMENTARY
(Product)
LITERATURE
(Product)
Reversibility
r=reversible
ir=irreversible
?=not specified
5'-O-(3-Thio)adenosine triphosphate + (deoxyribonucleotide)n + (deoxyribonucleotide)m
5'-O-(3-Thio)adenosine monophosphate + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
-
adenosine 5'-[alpha-thio]-triphosphate + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
the reaction rate is slower relative to reactions that use ATP. With adenosine 5'-[alpha-thio]-triphosphateas the cofactor, the ligase displays a significantly higher selectivity for ternary substrates having matched base pairs at the nick site
-
-
?
adenosine 5'-[alpha-thio]-triphosphate + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
the reaction rate is slower relative to reactions that use ATP. With ATP-alphaS as the cofactor, the ligase displays a significantly higher selectivity for ternary substrates having matched base pairs at the nick site
-
-
?
adenosine 5'-[beta,gamma-imido]-triphosphate + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
the ATP analogue has a different reactivity in the first reaction to adenylate the probe strand but the overall selectivity does not deviate from those observed when ATP is used
-
-
?
adenosine 5'-[gamma-thio]-triphosphate + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
the ATP analogue has a different reactivity in the first reaction to adenylate the probe strand but the overall selectivity does not deviate from those observed when ATP is used
-
-
?
ADP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + phosphate + (deoxyribonucleotide)n+m
show the reaction diagram
Aeropyrum pernix, Aeropyrum pernix DSM 11879
-
activity with ADP is slightly lower than with ATP
-
-
?
AMP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
the reaction rate is slower relative to reactions that use ATP
-
-
?
ATP + (2E,6E)-farnesyl diphosphate
adenosine 5'-((2E,6E)-farnesyl triphosphate) + diphosphate
show the reaction diagram
-
-
-
-
?
ATP + (2E,6E)-farnesyl triphosphate
adenosine 5'-((2E,6E)-farnesyl tetraphosphate) + diphosphate
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)20 + (deoxyribonucleotide)20
AMP + diphosphate + (deoxyribonucleotide)40
show the reaction diagram
-
sealing of a single nick in a 20mer DNA duplex, ADL is specific for nicked DNA and is not able to catalyze blunt end joining
-
?
ATP + (deoxyribonucleotide)30 + (deoxyribonucleotide)40
AMP + diphosphate + (deoxyribonucleotide)70
show the reaction diagram
Q9HHC4
ligTK displays little but significant ativity with NAD+
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
P18858
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
O29632
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
Paramecium bursaria chlorella virus
O41026
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
DNA ligase II can use oligo(dT)*poly(rA) as substrate, DNA ligase I not
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
novel form of enzyme different from DNA ligase I: has a unique binding site, which has an absolute requirement for single-strand breaks, unable to join blunt-ended DNA, even in the presence of polyethylene glycol concentrations which stimulate such joining by DNA ligase I and T4 DNA ligase, the enzyme lacks the AMP-dependent nicking/closing reaction
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
DNA ligase V does not join nicked templates with high efficiency, but can join double-strand breaks with a similar efficiency to DNA ligase I
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
unable to seal strands across a 1 nucleotide or 2 nucleotide gap. Ligase action at a 1 nucleotide gap results in accumulation of high levels of the normally undetectable DNA-adenylate reaction intermediate, no DNA-adenylate is formed at a 2 nucleotide gap
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
joins single-strand breaks in a double stranded polydeoxynucleotide in an ATP-dependent reaction, can join the hybrid substrates oligo(dT)*poly(rA) and oligo(rA)*poly(dT)
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
low DNA concentrations favor intramolecular reaction, i.e. recircularization, and higher concentrations favor intermolecular reaction, i.e. oligomerization and formation of recombinant molecules, some activity in joining RNA molecules annealed to DNA and even RNA:RNA molecules
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
DNA ligase I: performs blunt end ligation of DNA in presence of glycol, can ligate (rA)*poly(dT) hybrid substrate, unable to join oligo(rA)*poly(rU), unable to join oligo(dT)*poly(rA)
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
efficient strand joining on a single nicked DNA
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
DNA ligase III: repairs single-strand breaks in DNA, but is unable to perform either blunt end ligation or AMP-dependent relaxation of supercoiled DNA. The enzyme can join both the oligo(dT)*poly(rA) and oligo(rA)*poly(dT) hybrid substrates
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
overview: activity of DNA ligase on ribo- and deoxyribopolymer substrates
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
active on single-stranded RNA
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
can ligate nicked, cohesive, and blunt-ended DNA fragments
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
capable of joining (dT)20*(rA)n and (rA)12-18*(dT)n as well as (dT)20*(dA)n, ligation of blunt-ended DNA in the presence of polyethylene glycol 6000
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
catalyzes blunt end joining of DNA
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
catalyzes blunt end joining of DNA
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
repairs nicked duplex DNA substrates of a 5'-phosphate terminated strand and a 3'-hydroxyl-terminated strand annealed to a bridging template strand. Rapidly and efficiently joins a 3'OH RNA to 5'-phosphate DNA when the reacting polynucleotides are annealed to a bridging DNA strand. Ligation of 3'-OH DNA to 5'-phosphate RNA is 0.2% of the rate of RNA- to-DNA ligation. Requirement for B-form helical conformation on the 5'-phosphate side of the nick. Weak activity in RNA-to-RNA ligation on a bridging DNA template, incapable of joining two DNAs anneald on an RNA template
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
DNA ligase joins oligo(dT)*poly(A)
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
reverse reaction is catalyzed, the enzyme behaves as an AMP-dependent endonuclease, yielding nicked DNA
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
joins oligo(rA) annealed to poly(dT) with 250fold lower efficiency than it joins oligo(dT) annealed to poly(dA), ligates blunt-ended DNA fragments in the presence of 15% polyethylene glycol 80000
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
catalyzes blunt end ligation of DNA, cannot join an oligo(dT)*poly(rA) hybrid substrate
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
DNA ligase I joins single strand breaks in double stranded DNA, is active on oligo(dT) hybridized to poly(dA), and does not catalyze the joining of oligo(dT)*poly(rA). DNA ligase II and III catalyze the joining of oligo(dT)*poly(rA)
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
With 10% polyethylene glycol 6000, both cohesive end ligation and blunt end ligation is increased at high concentrations of salt, 150-200 mM NaCl, or 200-250 mM KCl. With 10% polyethylene glycol 6000, intermolecular and intamolecular ligation occurs at low salt concentrations, 0.100 mM NaCl or 0-150 mM KCl. Only linear oligomers are formed by intermolecular ligation at the high concentrations
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
reverse reaction: incubation of superhelical closed circular DNA molecules with the enzyme and AMP results in the production of a population of DNA molecules which have lost most of their superhelical density
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
joins restriction enzyme DNA fragments with staggered ends. Catalyzes blunt end ligation of DNA, this reaction is stimulated greatly by macromolecular crowding conditions. DNA ligase I is much more effective in blunt end joining than DNA ligase II and III, but is less efficient than T4 DNA ligase. DNA ligase acts at low efficiency as a topoisomerase, relaxing supercoiled DNA in an AMP-dependent reversal of the last step of the ligation reaction, joins oligo(dT) molecules hydrogen-bonded to poly(dA), is not able to ligate oligo(dT) with a poly(rA) complementary strand, can join oligo(rA) molecules hydrogen-bonded to poly(dT)
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
DNA ligase I and II ligate 5'-phosphoryl and 3'-hydroxyl groups in oligo(dT) in the presence of poly(dA). DNA ligase II can join oligo(dT)*poly(rA)
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
ligation of strand interruptions in oligo(dT)*poly(dA)
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
p(dT)7U can be joined when annealed with poly(dA), joining of oligonucleotides containing a single mismatched nucleotide at their 3'-hydroxyl termini, as well as DNA containing short, complementary 5'-protruding ends, and in the presence of glycol 6000, blunt-ended duplex DNA, in addition to joining DNA to DNA the enzyme can join the 5'-phosphoryl terminus of RNA to the 3'-hydroxyl terminus of DNA or RNA, when they are annealed with DNA
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
can join a 3'-hydroxyl terminus of DNA to a 5'-hydroxyl terminus of RNA, can join oligo(rA)12*poly(dT), blunt end joining in presence of polyethylene glycol
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
DNA ligase can reconstitute the transforming activity of Bacillus subtilis DNA inactivated by pancreatic DNAse, unable to use a hybrid substrate where an interrupted polydeoxynucleotide is annealed to a polyribonucleotide
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
inability to ligate oligo(dT)*poly(rA)
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
joins DNA annealed to RNA and, to a slight extent, even RNA annealed to its complementary RNA strand
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
converts nicked circular DNA molecules to a covalently closed form
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
ligates oligo(dT) with a poly(rA) complementary strand
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
ligation of flush-ended DNAs
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
joins the cohesive termini of bacteriophage lambda DNA covalently
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
DNA ligase I: seals single-strand breaks in DNA
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
conversion of nicked circular DNA to closed circular DNA
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
DNA ligase II: can catalyze joining of an oligo(dT)*poly(rA)
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
ATP-dependent ligase LigB displays vigorous nick sealing activity in presence of NAD+ and ATP, ATP-dependent ligase LigC displays weak nick joining activity and generates high levels of DNA adenylate intermediate, ATP-dependent ligase LigD displays weak nick joining activity and generates high levels of DNA adenylate intermediate
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
poly(ADP-ribose) polymerase-1 and XRCC1/DNA ligase III are involved in an alternative route for DNA double-strand breaks rejoining
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
the majority of end joining activity in extracts of HeLa cells derives from DNA ligase III. DNA ligase III is a candidate component of backup pathways of nonhomologous end joining. DNA ligase III joins both DNA strands practically simultaneously
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
Agrobacterium LigD1 is composed of a central ligase domain fused to a C-terminal polymerase-like (POL) domain and an N-terminal 3'-phosphoesterase (PE) module. The LigD1 protein seals DNA nicks, albeit inefficiently. The LigD1 POL domain has no detectable polymerase activity. The PE domain catalyzes metal-dependent phosphodiesterase and phosphomonoesterase reactions at a primer-template with a 3'-terminal diribonucleotide to yield a primertemplate with a monoribonucleotide 3'-OH end. The PE domain also has a 3'-phosphatase activity on an all-DNA primer-template that yields a 3'-OH DNA end, Agrobacterium LigD2 is composed of a central ligase domain fused to a C-terminal polymerase-like (POL) domain and an N-terminal 3'-phosphoesterase (PE) module. The LigD1 protein seals DNA nicks, albeit inefficiently. The LigD2 POL domain adds ribonucleotides or deoxyribonucleotides to a DNA primer-template, with rNTPs being the preferred substrates. The PE domain catalyzes metal-dependent phosphodiesterase and phosphomonoesterase reactions at a primer-template with a 3'-terminal diribonucleotide to yield a primer-template with a monoribonucleotide 3'-OH end. The PE domain also has a 3'-phosphatase activity on an all-DNA primer-template that yields a 3'-OH DNA end
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
ATP-dependent DNA ligase LigA is non-essential for cell viability. Haloferax volcanii also encodes the NAD+-dependent DNA ligase LigN. As with LigA, LigN is also non-essential for cell viability. Simultaneous inactivation of both proteins is lethal, however, indicating that they share an essential function
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
damaged DNA bases are repaired by base excision repair which can proceed via two pathways: short patch and long patch base excision repair. Inhibition of long patch base excision repair is mediated by the ligation activity of Lig III. Lowering the levels of XRCC1 and Lig III in HeLa cells decreases cellular repair capacity, but substantially increases Pol beta-dependent strand displacement DNA synthesis
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
P18858
detection and characterization of a direct physical interaction between DNA ligase I, proliferating cell nuclear antigen, a DNA sliding clamp, and, more recently, an interaction between DNA ligase I and replication factor C, the sliding clamp loader
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
DNA ligase IV is engaged in extrachromosomal circular major satellite synthesis
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
DNA non-homologous end-joining is a major mechanism for repairing DNA double-stranded breaks in mammalian cells. Key components of the DNA non-homologous end-joining machinery are the Ku heterodimer and the DNA ligase IC/Xrcc4 complex. Ku interacts with DNA ligase IV via its tandem BRCT domain. This interaction is enhanced in the presence of Xrcc4 and dsDNA. Ku nedds to be in its heterodimeric form to bind DNA ligase IV. Altough the interaction between Ku and DNA ligase IV/Xrcc4 occurs in the absence of DNA-PKc, the presence of the catalytic subunit of DNA-PK kinase enhances complex formation
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
P49916
interaction between DNA ligase III and DNA polymerase gamma plays an essential role in mitochondrial DNA stability
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
P49917
ligase IV/XRCC4 is the sole DNA ligase involved in the repair of double strand breaks via the non-homologous end joining pathway. Analogous to most other DNA ligases, ligase IV/XRCC4 is fairly intolerant of nicks containing mismatched base pairs
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
ligation of DNA is the ultimate step in DNA repair to restore genome integrity. Ligase I and III accumulate at DNA repair sites. DNA Ligase III accumulates at microirradiated sites before DNA ligase. Recruitment of DNA ligase I to sites of DNA damage depends on its interaction with PCNA
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
P18858
mitochondrial DNA ligase IIIalpha is critical for the mitochondrial function, role of DNA ligase IIIbeta in gametogenesis
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
XRCC4 and DNA ligase IV form a complex that is essential for the repair of all double-strand DNA breaks by the nonhomologous DNA end joining pathway in eukaryotes
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
enzyme is most sensitive to lesions on the 3'end of the nick compared to the 5'end and to lesions located in the intact template strand. Substrates containing the 8-oxo-7,8-dihydroguanosine/A mismatch are more readily ligated than those with the 8-oxo-7,8-dihydroguanosine/C mismatch. Ligations of duplexes containing the 8-oxo-7,8-dihydroguanosine/T base pair that could adopt an anti-anti conformation proceeds with high efficiencies. An 8-oxo-7,8-dihydroguanosine/A mismatch-containing duplex behaves like 8-oxo-7,8-dihydroinosine/A. Km-values increase by 90-100-fold for 8-oxo-7,8-dihydroguanosine/C-, 8-oxo-7,8-dihydroinosine/C-, 8-oxo-7,8-dihydroinosine/A-, and 8-oxo-7,8-dihydroadenosine/T-containing duplexes compared to that of a G/C-containing duplex. Substrates containing guanidinohydantoin/A, guanidinohydantoin/G, spiroiminodihydantoin/A, and spiroiminodihydantoin/G base pairs exhibit Km values 20-70fold higher than that of the substrate containing a G/base pair, while the Km value for 8-oxo-7,8-dihydroguanosine/A is 5 times lower than that for G/C
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
human XRCC4:DNA ligase IV can ligate two double-strand DNA ends that have fully incompatible short 3' overhang configurations with no potential for base pairing. At DNA ends that share 1-4 annealed base pairs, XRCC4:DNA ligase IV can ligate across gaps of 1 nt
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
PfLigI is able to join RNA-DNA substrates only when the RNA sequence is upstream of the nick. Slight activity with dATP. No activity with NAD+, UTP, CTP and GTP. Slight activity with dATP. No activity with NAD+, UTP, CTP or GTP
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
no DNA ligase activity in presence of ADP, AMP, and NAD+
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
annealing of two short oligonucleotides, a 5'-phosphate-terminated strand 30mer (phosphate-5'-AGGTCGACTCCAGAGGATTGTTGACCGGCC-3') and a 5'-TET labeled 20mer (TET-5'-CGCCAAGCTTGCATTCCTAC-3'), to a 40mer complementary oligonucleotide target (5'-CAATCCTCTGGAGTCGACCTGTAGGAATGCAAGCTTGGCG-3')
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
the donor strans is 42 bp (5'TCCGCGGATCCTGAGGTGAAATGTAAATGAAAAAGCCTGAAC3'), acceptor strand is 38 bp (5'CGTCGAGCAGCGAACCTACTGCGTGGCTTCCGGAGCTA3'), and the complement array stran is 80 bp (5'GTTCAGGCTTTTTCATTTACATTTCACCTCAGGATCCGCGGATAGCTCCGGAAGCCACGCAGTAGGTTCGCTGCTCGACG3')
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
Q57635
ATP is the best nucleotide cofactor for Methanocaldococcus jannaschii DNA ligase. dATP also exhibits some activation on ligation. All other nucleotide cofactors, including NAD+, NADH, UTP, CTP, GTP, dTTP, dCTP, and dGTP, play no role in ligation by the enzyme
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
both adenylyl transfer and phosphodiester bond formation appear to be effectively irreversible under the reaction conditions tested. The rates of the slowest chemical steps for reaction of both phosphorylated substrate and adenylylated substrate are found to be 10times faster than the steady state turnover rates for each substrate, suggesting that the true rate-limiting step during turnover is release of the ligated product or a post-product release conformational change
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
Aeropyrum pernix, Aeropyrum pernix DSM 11879
-
the enzyme is inactive when ATP was substituted by AMP or NAD+
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
r
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
r
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
B6ZH51
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
Q9P9K9
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
Q08387
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
Lymantria dispar multicapsid nucleopolyhedrovirus
Q9YMV2
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
Q9HHC4
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
Q50566
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
Q2PCE4
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
C4M5H3
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
both nick sealing and blunt end ligation
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
DNA ligase I is able to ligate nicks in oligo(dT)/poly(dA) and oligo(rA)/poly(dT) substrates but not in oligo(dT)/poly(rA) substrates, double-stranded DNA's with cohesive or blunt ends are also good substrates
ability of DNA ligase I to revert the ligation reaction by relaxing the supercoiled DNA
r
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
Lymantria dispar multicapsid nucleopolyhedrovirus
Q9YMV2
DNA ligase is able to ligate a double stranded synthetic DNA substrate containing a single nick and inefficiently ligates a 1-nucleotide gap but does not ligate a 2 nucleotide gap, it is able to ligate short complementary overhangs but not blunt-ended double-stranded DNA
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
inable to join oligo(dT) molecules hybridized to poly(rA)
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
joins 2 DNA sequences on a DNA template but not on a RNA template
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
ligates sticky end substrates efficiently but requires 10% polyethylene glycol 8000 for blunt end ligation
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
ligation activity of DNA ligase IV-XRCC4 complex depends upon substrate length, efficient ligation of a 445 bp substrate, little ligation of a 53 bp substrate
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
ligation of oligo(dT)/poly(dA)
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
ligation of oligo(dT)/poly(dA) and oligo(dT)/poly(rA) and oligo(rA)/poly(dT)
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
ligation of oligo(dT)/poly(dA) and oligo(dT)/poly(rA), unable to ligate oligo(rA)/poly(dT)
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
nick-ligation and blunt-end or sticky-end ligation
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
proper base pairing at the 3' side of the nick is necessary for efficient ligation
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
Q50566
strandjoining on a singly nicked DNA in the presence of a divalent cation and ATP
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
T4 DNA ligase is capable of joining 7-12mer DNA oligonucleotides containing in some cases up to 7 base pair mismatches
-
r
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
the concerted reaction of polynucleotide kinase and DNA ligase I can efficiently repair DNA nicks possessing 3'-phosphate and 5'-hydroxyl termini
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
DNA ligase I is involved in several important cellular pathways such as DNA replication, DNA repair and DNA recombination, DNA elongation by polymerase delta is strongly inhibited by DNA ligase I
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
DNA ligase I might be involved in repair of DNA strand breaks prior to the resumption of DNA synthesis
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
DNA ligase IV is involved in DNA-protein kinase-dependent form of non-homologous end joining
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
DNA ligase IV-XRCC4 complex functions in DNA non-homologous-end joining, the main pathwy for double-strand repair in mammalian cells
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
essential enzyme for completing DNA replication and DNA repair by ligating Okazaki fragments and by joining single-strand breaks formed either by DNA-damaging agents or indirectly by DNA repair enzymes, respectively
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
Q08387
probably involved in non-homologous end joining repair mechanism
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
catalyzes end-healing and end-sealing steps during nonhomologous end joining
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
possible role of the ligase in regulating minicircle replication
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
protein Rad54 and DNA ligase IV cooperate to support cellular proliferation, repair spontaneous double-strand breaks, and prevent chromosome and single chromatid aberrations
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
template-dependent and template-independent polymerase functions. LigD directs an imprecise non-homologous end-joining pathway for repairing blunt double-strand breaks. Another ATP-dependent DNA ligase (LigC) provides backup mechanism for LigD-independent error-prone repair of blunt-end double-strand breaks
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
the ability of DNA ligase I to promote the recombinational repair of DNA double-strand breaks is dependent upon its interaction with proliferating cell nuclear antigen. DNA ligase I-deficiency reduces recombinational repair of DNA double-strand breaks
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
DNA ligase of Africxan swine fever virus is the lowest-fidelity DNA ligase ever reported, capable of ligating a 3' C:T mismatched nick (where C and T are the templating and nascent nucleotides, respectively) more efficient than nicks containing Watson-Crick base pairs. The DNA ligase of African swine fever virus adenylates the 3'-amino-containing substrate extremely inefficiently, with reactions typically proceeding to only 5% completion
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
intrinsic polymerase function resident within an autonomous C-terminal polymerase domain, LigD-(533840), that flanks an autonomous DNA ligase domain, LigD-(188527)
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
template-dependent and template-independent polymerase functions
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
Q53E05
the kinetoplast-specific DNA ligase is proposed to be involved in the repair of gaps in the newly synthesized minicircles
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
the polymerase domain has DNA-dependent RNA primase activity, catalysing the synthesis of unprimed oligoribonucleotides on single-stranded DNA templates. The polymerase domain can also extend DNA in a template-dependent manner. The ligase domain catalyses the sealing of nicked double-stranded DNA designed to mimic a double-strand break, consistent with the role of Mt-Lig in non-homologous end-joining. The nuclease domain did not function independently as a 3'-5' exonuclease. Both the polymerase and ligase domains bind DNA in vitro, the latter with considerably higher affinity
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
DNA ligase I ligates Okazaki fragments during lagging strand DNA replication events
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
in the first step of catalysis, DNA ligase binds ATP, forming a high-energy covalent enzyme-nucleotide complex. Nucleophilic attack on the alpha-phosphorus of ATP results in cleavage of the triphosphate moiety, formation of the enzyme-AMP epsilon-amino lysyl phosphoramidate, and release of the diphosphate
-
-
r
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
C0LJI8
LigTh1519 is capable of ligating the cohesive ends and single-strand breaks in double-stranded DNA with ATP as cofactor
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
T4 DNA ligase catalyzes the formation of phosphodiester bonds between neighboring 3'-hydroxyl and 5'-phosphate ends in doublestranded DNA
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
synthetic 28-mer oligonucleotide duplex that contains a nick with a 3'-hydroxyl and a 5'-phosphate, more than 95% of the nicked DNA is ligated within 2 s
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
Entamoeba histolytica HM1:IMSS
C4M5H3
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
C0LJI8
LigTh1519 is capable of ligating the cohesive ends and single-strand breaks in double-stranded DNA with ATP as cofactor
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
Ferroplasma acidiphilum YT
Q2PCE4
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
DNA ligase mutations drastically affect DNA synthesis, little effect on genetic recombination and repair of UV damage
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
DNA ligase III plays a role in meiotic recombination
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
DNA ligase III seals DNA strand breaks that arise during the process of meiotic recombination in germ cells and as a consequence of DNA damage in somatic cells
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
nonessential for viral DNA replication and growth on several types of host cells. DNA ligase I participates in DNA base excision repair as a component of a multiprotein complex
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
mutants fail to produce progeny phage when grown on ligase-deficient strains of E. coli
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
DNA ligase I is involved in DNA repair and genetic recombination and is required for replication
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
DNA ligase is biologically active to endonucleolytically cleaved pBR322 DNA
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
DNA ligase II might work at the final step of meiotic recombination reaction
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
DNA ligase III is active in DNA repair and recombination
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
DNA ligase III-beta is expressed only in male meiotic germ cells, suggesting a role for this isoform in meiotic recombination
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
DNA ligase I is the key enzyme for joining Okazaki fragments during lagging-strand DNA synthesis in mammalian cells and also for completion of DNA excision repair processes
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
DNA ligase I is involved in DNA replication
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
DNA ligase III may be involved in DNA repair
-
-
-
ATP + (single-stranded DNA splinted by RNA)m + (single-stranded DNA splinted by RNA)n
AMP + diphosphate + (single-stranded DNA splinted by RNA)m+n
show the reaction diagram
-
-
-
-
?
ATP + ADP
P1-(5'-adenosyl),P3-(5'-adenosyl)tetraphosphate + diphosphate
show the reaction diagram
P56709
-
-
-
?
ATP + CDP
P1-(5'-adenosyl),P3-(5'-guanosyl)tetraphosphate + diphosphate
show the reaction diagram
P56709
-
-
-
?
ATP + clodronate
adenosine 5'-triphosphate derivative of clodronate + diphosphate
show the reaction diagram
-
-
-
-
?
ATP + CTP
P1-(5'-adenosyl),P4-(5'-cytidyl)tetraphosphate + diphosphate
show the reaction diagram
P56709
-
-
-
?
ATP + dCTP
P1-(5'-adenosyl),P4-[5'-(2'-deoxycytidyl)]tetraphosphate + diphosphate
show the reaction diagram
P56709
-
-
-
?
ATP + dGTP
P1-(5'-adenosyl),P4-[5'-(2'-deoxyguanosyl)]tetraphosphate + diphosphate
show the reaction diagram
P56709
-
-
-
?
ATP + dimethylallyl diphosphate
adenosine 5'-dimethylallyltriphosphate + diphosphate
show the reaction diagram
-
-
-
-
?
ATP + DNA substrate S4
AMP + diphosphate + ?
show the reaction diagram
Sulfolobus tokodaii, Sulfolobus tokodaii 7
Q976G4
-
-
-
?
ATP + dTTP
P1-(5'-adenosyl),P4-(5'-thymidyl)tetraphosphate + diphosphate
show the reaction diagram
P56709
-
-
-
?
ATP + etidronate
adenosine 5'-triphosphate derivative of etidronate + diphosphate
show the reaction diagram
-
-
-
-
?
ATP + GDP
P1-(5'-adenosyl),P3-(5'-guanosyl)tetraphosphate + diphosphate
show the reaction diagram
P56709
-
-
-
?
ATP + geranyl diphosphate
adenosine 5'-geranyl triphosphate + diphosphate
show the reaction diagram
-
-
-
-
?
ATP + geranyl triphosphate
adenosine 5'-geranyl tetraphosphate + diphosphate
show the reaction diagram
-
-
-
-
?
ATP + GTP
P1-(5'-adenosyl),P4-(5'-guanosyl)tetraphosphate + diphosphate
show the reaction diagram
P56709
-
-
-
?
ATP + isopentenyl diphosphate
adenosine 5'-isopentenyl triphosphate + diphosphate
show the reaction diagram
-
-
-
-
?
ATP + isopentenyl triphosphate
adenosine 5'-isopentenyl tetraphosphate + diphosphate
show the reaction diagram
-
-
-
-
?
ATP + methylenebisphosphonate
adenosine 5'-triphosphate derivative of methylenebisphosphonate + diphosphate
show the reaction diagram
-
-
-
-
?
ATP + tripolyphosphate
adenosine 5'-triphosphate derivative of tripolyphosphate + diphosphate
show the reaction diagram
-
-
-
-
?
ATP + UTP
P1-(5'-adenosyl),P4-(5'-uridinyl)tetraphosphate + diphosphate
show the reaction diagram
P56709
-
-
-
?
ATP + XDP
P1-(5'-adenosyl),P3-(5'-xanthosyl)tetraphosphate + diphosphate
show the reaction diagram
P56709
-
-
-
dip
ATP + XTP
P1-(5'-adenosyl),P4-(5'-xanthosyl)tetraphosphate + diphosphate
show the reaction diagram
P56709
-
-
-
?
ATPalphaS + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
DNA ligase II can use ATPalphaS much more efficiently than DNA ligase I
-
-
-
dATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
dAMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
-
dATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
dAMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
-
dATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
dAMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
at 0.5% of the activity relative to ATP
-
-
-
dATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
dAMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
at 35-50% of the activity relative to ATP
-
-
-
dATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
dAMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
-
?
dATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
dAMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
Q9P9K9
very low activity
-
?
dATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
dAMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
Q50566
strandjoining on a singly nicked DNA in the presence of a divalent cation and dATP, approx. 10% of activity with ATP
-
?
additional information
?
-
-
-
-
-
-
additional information
?
-
-
ATP-diphosphate exchange reaction
-
-
-
additional information
?
-
-
ATP-diphosphate exchange reaction
-
-
-
additional information
?
-
-
DNA ligase I is induced upon cell proliferation, DNA ligase II, and III not
-
-
-
additional information
?
-
-
potential role of the LigD 3'-ribonuclease and 3'-phosphatase activities of DNA ligase D in healing damaged ends via ribonucleotide incorporation at non-homologous end joining junctions
-
-
-
additional information
?
-
P00969
the ATP-dependent DNA ligase from bacteriophage T7 is a two-domain ligase: the adenylation or nucleotide-binding domain binds ATP and is connected to an OB-fold domain by a flexible linker. The ATP-binding pocket within the amino-terminal domain of bacteriophage T7 is formed by two antiparallel beta-sheets flanked by R-helices
-
-
-
additional information
?
-
-
CVLig relaxes negatively supercoiled plasmid DNA in the presence of 10 mM AMP to generate a mixture of partially relaxed topoisomers, fully relaxed circles, and nicked circular products
-
-
-
additional information
?
-
-
deficient caspases activation in apoptosis-resistant cancer cells depends on DNA-ligase IV playing a crucial role in the nonhomologous end joining pathway, DNA damage left unrepaired by DNA-ligase IV may be the initiator for caspases activation by doxorubicin in cancer cells
-
-
-
additional information
?
-
-
dissociation of the ligase IV/XRCC4 complex occurs at an early stage in E4 34k-mediated degradation of ligase IV and indicates a role for E4 34k in dissociation of the ligase IV/XRCCC4 complex
-
-
-
additional information
?
-
-
during adenovirus type 5 infection, ligase IV is targeted for degradation in a process that requires expression of the viral E1B 55k and E4 34k proteins while XRCC4 and XLF protein levels remain unchanged, E1B 55k/E4 34-dependent degradation of ligase IV is accompanied by the unexpected loss of DNA binding by XRCC4
-
-
-
additional information
?
-
-
T4 DNA can adenylate the 5'-phosphorylated donor DNA substrate with a DNA template, ATP, and an acceptor strand that has a strategically chosen C-T acceptor-template mismatch directly adjacent to the adenylation site, between 0.5 and 10 mM ATP the adenylation yield is high (about 60%), whereas the yield is lower outside of this range
-
-
-
additional information
?
-
-
Werner protein physically interacts with X4L4 which stimulates Werner protein exonuclease but not its helicase activity, human RecQ helicase BLM protein which possesses only helicase activity, does not bind to X4L4, and its helicase activity is not affected by X4L4
-
-
-
additional information
?
-
-
in the first, the ligase reacts with ATP to covalently modify an active site lysine residue with AMP. In the second step, the ligase transfers the AMP moiety to the 5' phosphate group of the substrate DNA strand. In the third step, the 3' hydroxyl group of the other strand reacts with the activated strand to give a native phosphodiester linkage with concomitant release of AMP
-
-
-
additional information
?
-
-
in the first, the ligase reacts with ATP to covalently modify an active site lysine residue with AMP. In the second step, the ligase transfers the AMP moiety to the 5'-phosphate group of the substrate DNA strand. In the third step, the 3'-hydroxyl group of the other strand reacts with the activated strand to give a native phosphodiester linkage with concomitant release of AMP
-
-
-
additional information
?
-
-
base-pairing of oxanine and cytosine between the ligation fragment and template influences the ligation performance of the T4 DNA ligase to a lesser degree compared to guanine-cytosine base pairing
-
-
-
additional information
?
-
-
successful ligation for G:C and no ligation for G:T is observed when oxanine is employed adjacent to guanine in the ligation junction
-
-
-
additional information
?
-
-
T4 ligase has a low specificity for adenylating the 5' strand, the ternary complexes having A:G, G:A and C:C mismatched base pairs are efficient substrates for adenylation even though they yield little ligated product
-
-
-
additional information
?
-
-
the DNA binding domain of human DNA ligase I interacts with both nicked DNA and the DNA sliding clamps, proliferating cell nuclear antigen and hRad9-hRad1-hHus1
-
-
-
additional information
?
-
C4M5H3
DNAligI performs the three conserved steps of a DNA ligation reaction: adenylation, binding to a 5'-phosphorylated nicked DNA substrate and sealing of the nick. DNAligI is also able to ligate a RNA strand upstream of a nucleic acid nick, but not in the downstream or the template position
-
-
-
additional information
?
-
-
for efficient ligation, ligase III-alpha is constitutively bound to the scaffolding protein XRCC1 through interactions between the C-terminal BRCT domains of each protein
-
-
-
additional information
?
-
-
LIG1 catalyzes the ligation of single-strand breaks to complete DNA replication and repair. The energy of ATP is used to form a new phosphodiester bond in DNA via a reaction mechanism that involves three distinct chemical steps: enzyme adenylylation, adenylyl transfer to DNA, and nick sealing
-
-
-
additional information
?
-
-
LIG1 repairs single-strand breaks
-
-
-
additional information
?
-
-
ligation by T4 DNA ligase is dependent on the formation of a double stranded DNA duplex of at least five base pairs surrounding the site of ligation. However, ligations can be performed effectively with overhangs smaller than five base pairs and oligonucleotides as small as octamers, in the presence of a second, complementary oligonucleotide
-
-
-
additional information
?
-
-
T4 DNA ligase is also able to capture RNA strands in which a tethered monodeoxynucleoside has acquired a 5' phosphate. The ligation reaction therefore mimics the partition step of a selection for nucleoside kinase (deoxy)ribozymes
-
-
-
additional information
?
-
-
the PolDom domain of LigD is required for efficient and accurate DNA repair and increases deletions in re-circularized plasmid DNA when expressed with Ku protein in Escherichia coli. The LigDom domain of LigD can function in Ku-dependent repair
-
-
-
additional information
?
-
P56709
the rate of synthesis of Ap4N is double that of the corresponding Ap3N
-
-
-
additional information
?
-
-
abortive adenylylation is suppressed at low ATP concentrations (below 100 mM) and pH higher than 8, leading to increased product yields. The ligation reaction is rapid for a broad range of substrate sequences, but is relatively slower for substrates with a 5'-phosphorylated dC or dG residue on the 3' side of the ligation junction
-
-
-
additional information
?
-
Entamoeba histolytica HM1:IMSS
C4M5H3
DNAligI performs the three conserved steps of a DNA ligation reaction: adenylation, binding to a 5'-phosphorylated nicked DNA substrate and sealing of the nick. DNAligI is also able to ligate a RNA strand upstream of a nucleic acid nick, but not in the downstream or the template position
-
-
-
NATURAL SUBSTRATES
NATURAL PRODUCTS
REACTION DIAGRAM
ORGANISM
UNIPROT
COMMENTARY
(Substrate)
LITERATURE
(Substrate)
COMMENTARY
(Product)
LITERATURE
(Product)
REVERSIBILITY
r=reversible
ir=irreversible
?=not specified
ATP + (deoxyribonucleotide)20 + (deoxyribonucleotide)20
AMP + diphosphate + (deoxyribonucleotide)40
show the reaction diagram
-
sealing of a single nick in a 20mer DNA duplex, ADL is specific for nicked DNA and is not able to catalyze blunt end joining
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
P18858
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
O29632
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
ATP-dependent ligase LigB displays vigorous nick sealing activity in presence of NAD+ and ATP, ATP-dependent ligase LigC displays weak nick joining activity and generates high levels of DNA adenylate intermediate, ATP-dependent ligase LigD displays weak nick joining activity and generates high levels of DNA adenylate intermediate
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
poly(ADP-ribose) polymerase-1 and XRCC1/DNA ligase III are involved in an alternative route for DNA double-strand breaks rejoining
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
Agrobacterium LigD1 is composed of a central ligase domain fused to a C-terminal polymerase-like (POL) domain and an N-terminal 3'-phosphoesterase (PE) module. The LigD1 protein seals DNA nicks, albeit inefficiently. The LigD1 POL domain has no detectable polymerase activity. The PE domain catalyzes metal-dependent phosphodiesterase and phosphomonoesterase reactions at a primer-template with a 3'-terminal diribonucleotide to yield a primertemplate with a monoribonucleotide 3'-OH end. The PE domain also has a 3'-phosphatase activity on an all-DNA primer-template that yields a 3'-OH DNA end, Agrobacterium LigD2 is composed of a central ligase domain fused to a C-terminal polymerase-like (POL) domain and an N-terminal 3'-phosphoesterase (PE) module. The LigD1 protein seals DNA nicks, albeit inefficiently. The LigD2 POL domain adds ribonucleotides or deoxyribonucleotides to a DNA primer-template, with rNTPs being the preferred substrates. The PE domain catalyzes metal-dependent phosphodiesterase and phosphomonoesterase reactions at a primer-template with a 3'-terminal diribonucleotide to yield a primer-template with a monoribonucleotide 3'-OH end. The PE domain also has a 3'-phosphatase activity on an all-DNA primer-template that yields a 3'-OH DNA end
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
ATP-dependent DNA ligase LigA is non-essential for cell viability. Haloferax volcanii also encodes the NAD+-dependent DNA ligase LigN. As with LigA, LigN is also non-essential for cell viability. Simultaneous inactivation of both proteins is lethal, however, indicating that they share an essential function
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
damaged DNA bases are repaired by base excision repair which can proceed via two pathways: short patch and long patch base excision repair. Inhibition of long patch base excision repair is mediated by the ligation activity of Lig III. Lowering the levels of XRCC1 and Lig III in HeLa cells decreases cellular repair capacity, but substantially increases Pol beta-dependent strand displacement DNA synthesis
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
P18858
detection and characterization of a direct physical interaction between DNA ligase I, proliferating cell nuclear antigen, a DNA sliding clamp, and, more recently, an interaction between DNA ligase I and replication factor C, the sliding clamp loader
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
DNA ligase IV is engaged in extrachromosomal circular major satellite synthesis
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
DNA non-homologous end-joining is a major mechanism for repairing DNA double-stranded breaks in mammalian cells. Key components of the DNA non-homologous end-joining machinery are the Ku heterodimer and the DNA ligase IC/Xrcc4 complex. Ku interacts with DNA ligase IV via its tandem BRCT domain. This interaction is enhanced in the presence of Xrcc4 and dsDNA. Ku nedds to be in its heterodimeric form to bind DNA ligase IV. Altough the interaction between Ku and DNA ligase IV/Xrcc4 occurs in the absence of DNA-PKc, the presence of the catalytic subunit of DNA-PK kinase enhances complex formation
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
P49916
interaction between DNA ligase III and DNA polymerase gamma plays an essential role in mitochondrial DNA stability
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
P49917
ligase IV/XRCC4 is the sole DNA ligase involved in the repair of double strand breaks via the non-homologous end joining pathway. Analogous to most other DNA ligases, ligase IV/XRCC4 is fairly intolerant of nicks containing mismatched base pairs
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
ligation of DNA is the ultimate step in DNA repair to restore genome integrity. Ligase I and III accumulate at DNA repair sites. DNA Ligase III accumulates at microirradiated sites before DNA ligase. Recruitment of DNA ligase I to sites of DNA damage depends on its interaction with PCNA
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
P18858
mitochondrial DNA ligase IIIalpha is critical for the mitochondrial function, role of DNA ligase IIIbeta in gametogenesis
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
XRCC4 and DNA ligase IV form a complex that is essential for the repair of all double-strand DNA breaks by the nonhomologous DNA end joining pathway in eukaryotes
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
r
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
r
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
Q9P9K9
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
Lymantria dispar multicapsid nucleopolyhedrovirus
Q9YMV2
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
Q9HHC4
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
Q50566
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
nick-ligation and blunt-end or sticky-end ligation
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
DNA ligase I is involved in several important cellular pathways such as DNA replication, DNA repair and DNA recombination, DNA elongation by polymerase delta is strongly inhibited by DNA ligase I
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
DNA ligase I might be involved in repair of DNA strand breaks prior to the resumption of DNA synthesis
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
DNA ligase IV is involved in DNA-protein kinase-dependent form of non-homologous end joining
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
DNA ligase IV-XRCC4 complex functions in DNA non-homologous-end joining, the main pathwy for double-strand repair in mammalian cells
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
essential enzyme for completing DNA replication and DNA repair by ligating Okazaki fragments and by joining single-strand breaks formed either by DNA-damaging agents or indirectly by DNA repair enzymes, respectively
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
Q08387
probably involved in non-homologous end joining repair mechanism
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
catalyzes end-healing and end-sealing steps during nonhomologous end joining
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
possible role of the ligase in regulating minicircle replication
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
protein Rad54 and DNA ligase IV cooperate to support cellular proliferation, repair spontaneous double-strand breaks, and prevent chromosome and single chromatid aberrations
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
template-dependent and template-independent polymerase functions. LigD directs an imprecise non-homologous end-joining pathway for repairing blunt double-strand breaks. Another ATP-dependent DNA ligase (LigC) provides backup mechanism for LigD-independent error-prone repair of blunt-end double-strand breaks
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
the ability of DNA ligase I to promote the recombinational repair of DNA double-strand breaks is dependent upon its interaction with proliferating cell nuclear antigen. DNA ligase I-deficiency reduces recombinational repair of DNA double-strand breaks
-
-
?
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
-
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
DNA ligase mutations drastically affect DNA synthesis, little effect on genetic recombination and repair of UV damage
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
DNA ligase III plays a role in meiotic recombination
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
DNA ligase III seals DNA strand breaks that arise during the process of meiotic recombination in germ cells and as a consequence of DNA damage in somatic cells
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
nonessential for viral DNA replication and growth on several types of host cells. DNA ligase I participates in DNA base excision repair as a component of a multiprotein complex
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
mutants fail to produce progeny phage when grown on ligase-deficient strains of E. coli
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
DNA ligase I is involved in DNA repair and genetic recombination and is required for replication
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
DNA ligase is biologically active to endonucleolytically cleaved pBR322 DNA
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
DNA ligase II might work at the final step of meiotic recombination reaction
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
DNA ligase III is active in DNA repair and recombination
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
DNA ligase III-beta is expressed only in male meiotic germ cells, suggesting a role for this isoform in meiotic recombination
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
DNA ligase I is the key enzyme for joining Okazaki fragments during lagging-strand DNA synthesis in mammalian cells and also for completion of DNA excision repair processes
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
DNA ligase I is involved in DNA replication
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
?
show the reaction diagram
-
DNA ligase III may be involved in DNA repair
-
-
-
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
AMP + diphosphate + (deoxyribonucleotide)n+m
show the reaction diagram
-
-
-
-
?
dATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m
dAMP + diphosphate + (deoxyribonucleotide)m+n
show the reaction diagram
-
-
-
-
?
additional information
?
-
-
potential role of the LigD 3'-ribonuclease and 3'-phosphatase activities of DNA ligase D in healing damaged ends via ribonucleotide incorporation at non-homologous end joining junctions
-
-
-
additional information
?
-
-
CVLig relaxes negatively supercoiled plasmid DNA in the presence of 10 mM AMP to generate a mixture of partially relaxed topoisomers, fully relaxed circles, and nicked circular products
-
-
-
additional information
?
-
-
deficient caspases activation in apoptosis-resistant cancer cells depends on DNA-ligase IV playing a crucial role in the nonhomologous end joining pathway, DNA damage left unrepaired by DNA-ligase IV may be the initiator for caspases activation by doxorubicin in cancer cells
-
-
-
additional information
?
-
-
dissociation of the ligase IV/XRCC4 complex occurs at an early stage in E4 34k-mediated degradation of ligase IV and indicates a role for E4 34k in dissociation of the ligase IV/XRCCC4 complex
-
-
-
additional information
?
-
-
during adenovirus type 5 infection, ligase IV is targeted for degradation in a process that requires expression of the viral E1B 55k and E4 34k proteins while XRCC4 and XLF protein levels remain unchanged, E1B 55k/E4 34-dependent degradation of ligase IV is accompanied by the unexpected loss of DNA binding by XRCC4
-
-
-
additional information
?
-
-
in the first, the ligase reacts with ATP to covalently modify an active site lysine residue with AMP. In the second step, the ligase transfers the AMP moiety to the 5' phosphate group of the substrate DNA strand. In the third step, the 3' hydroxyl group of the other strand reacts with the activated strand to give a native phosphodiester linkage with concomitant release of AMP
-
-
-
additional information
?
-
-
in the first, the ligase reacts with ATP to covalently modify an active site lysine residue with AMP. In the second step, the ligase transfers the AMP moiety to the 5'-phosphate group of the substrate DNA strand. In the third step, the 3'-hydroxyl group of the other strand reacts with the activated strand to give a native phosphodiester linkage with concomitant release of AMP
-
-
-
COFACTOR
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
IMAGE
ATP
B6ZH51
-
ATP
Q2PCE4
ATP is preferred over NAD+
ATP
-
dependent on
ATP
-
the ligation does not take place unless ATP is added to the ligation mixture
ATP
-
dependent on
ATP
-
the efficiency of ligation falls from near 100% under optimal conditions with 1 mM Mg2+ and 10 mM ATP to 60% with 1 mM Mg2+ and 2 mM ATP
ATP
C4M5H3
specifically dependent on ATP
NAD+
Q2PCE4
uses also NAD+ as cofactor although ATP is preferred
additional information
C4M5H3
DNAligI is not active using NAD+, UTP, CTP, GTP, dATP, and dGTP as cofactors
-
additional information
-
enzyme shows a broad nucleotide cofactor specificity
-
METALS and IONS
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
Ca2+
-
approx. 10% of activity with Mg2+
Ca2+
-
9% of activity with Mg2+, maximal activity at 5 mM, inhibition above 40 mM
Ca2+
Q9P9K9
divalent cation required for activity, most effectiv cation together with Mg2+ for native DNA ligase, maximal activity at 5 mM
Ca2+
-
1 mM, supports autoadenylation reaction. Does not support nick-joining activity at 2-5 mM
Ca2+
-
5 mM, increases activity 9fold
Ca2+
-
enzyme can utilize Ca2+ as cofactor
Ca2+
-
the enzyme requires Mg2+ or Mn2+ for activity, Ca2+ or Co2+ are less effective
Ca2+
Q57635
exhibits some activation on ligation
Cd2+
-
1 mM, supports autoadenylation reaction. Does not support nick-joining activity at 2-5 mM
Co2+
-
approx. 12% of activity with Mg2+
Co2+
Q50566
10 mM, divalent cation required for activity
Co2+
-
1 mM, supports autoadenylation reaction. Does not support nick-joining activity at 2-5 mM
Co2+
-
nick sealing by LigD in the presence of 0.1 mM ATP requires a divalent cation cofactor. Cobalt supports the conversion of the 12-mer pDNA strand to a 24-mer which es elongated to 25-mer and 26-mer products
Co2+
-
the enzyme requires Mg2+ or Mn2+ for activity, Ca2+ or Co2+ are less effective
Cu2+
-
1 mM, supports autoadenylation reaction. Does not support nick-joining activity at 2-5 mM
Fe3+
Q2PCE4
contains two Fe3+-tyrosinate centers, reduction of the Fe3+ to Fe2+ results in an 80% decrease in DNA substrate binding and an increase in the pH activity optimum to 5.0
K+
-
polyethylene glycol 6000, 15%, stimulates, when NaCl and KCl are both absent. With 10% polyethylene glycol 6000, both cohesive and blunt end ligation are increased at high concentrations of salt, 150-200 mM NaCl, or 200-250 mM KCl. With 10% polyethylene glycol 6000, intermolecular and intramolecular ligation occurs at low salt concentrations, 0.1 mM NaCl or 0-150 mM KCl. Only linear oligomers are formed by intermolecular ligation at the high concentrations
K+
-
3fold stimulation at 70 mM KCl, 4fold stimulation at 150 mM KCl
K+
Q9HHC4
monovalent cations stimulate activity, maximal activation at 10-30 mM
KCl
-
optimum concentration: 5 mM
Mg2+
-
optimal concentration: 10 mM; required
Mg2+
-
required
Mg2+
-
optimal concentration: 10 mM
Mg2+
-
-
Mg2+
-
Km: 3 mM; required
Mg2+
-
Km: 2.7 mM; Mn2+ or Mn2+ required
Mg2+
-
Km: 0.9 mM; required
Mg2+
-
Mn2+ or Mn2+ required; optimal concentration 5 mM
Mg2+
-
Mn2+ and Ca2+ cannot replace Mg2+ in activation; required
Mg2+
-
required
Mg2+
-
optimal concentration: 10 mM; required
Mg2+
-
required
Mg2+
-
Mn2+ is more effective than Mg2+ at 0.5-1 mM; Mn2+ or Mn2+ required
Mg2+
-
required
Mg2+
-
required
Mg2+
-
absolutely required for activity, maximal activity at 2 mM
Mg2+
-
required for activity
Mg2+
-
divalent cation required for activity, maximal activity at 15 mM
Mg2+
-
divalent cation required for activity, maximal activity at approx. 10 mM
Mg2+
Q9P9K9
divalent cation required for activity, most effectiv cation together with Ca2+ for native DNA ligase, maximal activity at 5 mM
Mg2+
Q9HHC4
required for activity, maximal activity at 14-18 mM
Mg2+
Q50566
10 mM, divalent cation required for activity
Mg2+
-
required for activity
Mg2+
-
1 mM, supports autoadenylation reaction. Required for nick-joining activity at 2-5 mM
Mg2+
-
5 mM, increases activity 9fold
Mg2+
-
nick sealing by LigD in the presence of 0.1 mM ATP requires a divalent cation cofactor. Magnesium supports the conversion of the 12-mer pDNA strand to a discrete 24-mer ligation product. An additional minor species corresponding to AppDNA is also produced
Mg2+
-
efficient nick-joining is observed in the presence of Mg2+ and Mn2+
Mg2+
-
maximal activation at 0.6 mM
Mg2+
-
10 mM, required for activity
Mg2+
-
optimum concentration at 50 mM
Mg2+
Q976G4
-
Mg2+
-
required
Mg2+
-
required for activity
Mg2+
-
optimum concentration at 5 mM
Mg2+
-
the ligation does not take place unless Mg2+ is added to the ligation mixture
Mg2+
-
LIG1 requires multiple Mg2+ ions for catalysis
Mg2+
C4M5H3
DNAligI uses Mn2+ or Mg2+ as metal cofactors, optimal ligation activity at 4 mM of Mg2+
Mg2+
-
LigD has 3'-5' single-stranded DNA exonuclease activity that requires magnesium or manganese
Mg2+
-
optimal concentration: 4 mM
Mg2+
-
required
Mg2+
-
optimal concentration: 15 mM, the enzyme requires Mg2+ or Mn2+ for activity, Ca2+ or Co2+ are less effective
Mg2+
Paramecium bursaria chlorella virus
O41026
10 mM, standard reaction condition
Mg2+
Q57635
dependent on metal ions of Mg2+ and Mn2+. Ligation activity with a 2 to 25 mM concentration, optimal Mg2+ concentration is 10 mM
Mn2+
-
25% as effective as Mg2+ in activation
Mn2+
-
Km: 0.3 mM; Mg2+ or Mn2+ required
Mn2+
-
Mg2+ or Mn2+ required; optimal concentration: 0.5 mM
Mn2+
-
Mn2+ cannot replace Mg2+ in activation
Mn2+
-
Mg2+ or Mn2+ required; Mn2+ is more effective than Mg2+ at 0.5-1 mM
Mn2+
-
approx. 20% of activity with Mg2+
Mn2+
-
required for activity
Mn2+
-
65% of activity with Mg2+, maximal activity at 25 mM
Mn2+
-
divalent cation required for activity
Mn2+
Q9P9K9
divalent cation required for activity, most effectiv cation for recombinant DNA ligase, 10times higher efficiency than with Mg2+, maximal activity at 2-5 mM
Mn2+
Q50566
10 mM, divalent cation required for activity
Mn2+
-
1 mM, supports autoadenylation reaction. Supports nick-joining activity to a much lesser extent than Mg2+
Mn2+
-
5 mM, increases activity 7fold
Mn2+
-
nick sealing by LigD in the presence of 0.1 mM ATP requires a divalent cation cofactor. Conversion of the 12-mer pDNA strand results in ligated products consisting of a triplet of 24-, 25-, and 26-mer species. In addition, manganese prompted the appearance of discrete radiolabeled 13- and 14-mer species
Mn2+
-
efficient nick-joining is observed in the presence of Mg2+ and Mn2+
Mn2+
-
maximal activation at 6 mM
Mn2+
C4M5H3
DNAligI uses Mn2+ or Mg2+ as metal cofactors, optimal ligation activity at 1 mM of Mn2+
Mn2+
-
LigD has 3'-5' single-stranded DNA exonuclease activity that requires magnesium or manganese
Mn2+
-
the enzyme is most active when Mn2+ is present as divalent metal cofactor rather than Mg2+ and Ca2+ etc.
Mn2+
-
required
Mn2+
-
optimal concentration: 7.5 mM, the enzyme requires Mg2+ or Mn2+ for activity, Ca2+ or Co2+ are less effective
Mn2+
-
increases activity
Na+
-
polyethylene glycol 6000, 15%, stimulates, when NaCl and KCl are both absent. With 10% polyethylene glycol 6000, both cohesive end ligation and blunt end ligation are increased at high concentrations of salt, 150-200 mM NaCl, or 200-250 mM KCl. With 10% polyethylene glycol 6000, intermolecular and intramolecular ligation occurs at low salt concentrations, 0.1 mM NaCl or 0-150 mM KCl. Only linear oligomers are formed by intermolecular ligation at the high concentrations
Na+
-
KCl is required for optimal activity, 3fold stimulation at 30 mM NaCl, 4fold stimulation at 150 mM NaCl
Na+
-
optimum concentration at 100 mM
Na+
-
in 80 mM NaCl LigIII binds non-specifically to DNA, showing equal affinity for nicked and intact DNA, in 250 mM NaCl LigIII binds specifically to nicked DNA does not bind measurably to duplex DNA
NaCl
-
promotes enzyme activity, optimal concentration: 300 mM
NaCl
-
rate of ligation is inhibited by concentrations of more than 100 mM NaCl
Ni2+
-
approx. 18% of activity with Mg2+
Ni2+
-
1 mM, supports autoadenylation reaction. Does not support nick-joining activity at 2-5 mM
Sr2+
-
40% of activity with Mg2+, maximal activity at 25 mM
Zn2+
-
1 mM, supports autoadenylation reaction. Does not support nick-joining activity at 2-5 mM
Zn2+
-
the enzyme contains a PARP-like zinc finger
Zn2+
-
Lig3 contains a zinc finger
Mn2+
Q57635
dependent on metal ions of Mg2+ and Mn2+
additional information
-
DNA ligase I is active at low salt concentrations, 0-30 mM KCl, DNA ligase II is active at high salt concentrations, 50-100 mM KCl
additional information
Q2PCE4
catalytic activity neither depends on nor is stimulated by added Mg2+ or K+
INHIBITORS
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
IMAGE
(1S,3S)-3-acetyl-3,5,10-trihydroxy-6,11-dioxo-1,2,3,4,6,11-hexahydrotetracen-1-yl 3-amino-2,3,6-trideoxy-alpha-L-lyxo-hexopyranoside
-
-
(2-hydroxyphenyl)(4-hydroxyphenyl)methanone
-
50.7% inhibition at 0.1 mM
(3S)-3,5,12-trihydroxy-3-(hydroxyacetyl)-10-methoxy-6,11-dioxo-1,2,3,4,5a,6,11,11a-octahydrotetracen-1-yl 3-(2-cyanopiperidin-1-yl)-2,3,6-trideoxy-alpha-D-glycero-hexopyranoside
-
-
(3S)-3,5,12-trihydroxy-3-(hydroxyacetyl)-10-methoxy-6,11-dioxo-1,2,3,4,5a,6,11,11a-octahydrotetracen-1-yl-2,6-dideoxy-beta-L-threo-hexopyranoside
-
-
(3S)-3,5,12-trihydroxy-3-(hydroxyacetyl)-10-methoxy-6,11-dioxo-1,2,3,4,5a,6,11,11a-octahydrotetracen-1-yl-3-amino-2,3,6-trideoxy-alpha-D-erythro-hexopyranoside
-
-
(3S)-3,5,12-trihydroxy-3-(hydroxyacetyl)-10-methoxy-6,11-dioxo-1,2,3,4,5a,6,11,11a-octahydrotetracen-1-yl-3-amino-2,3,6-trideoxy-beta-L-threo-hexopyranoside
-
-
(3S)-3,5,12-trihydroxy-3-(hydroxyacetyl)-10-methoxy-6,11-dioxo-1,2,3,4,5a,6,11,11a-octahydrotetracen-1-yl-4-amino-2,4,6-trideoxy-alpha-D-erythro-hexopyranoside
-
-
(3S)-3,5,12-trihydroxy-3-(hydroxyacetyl)-6,11-dioxo-1,2,3,4,5a,6,11,11a-octahydrotetracen-1-yl-2,6-dideoxy-beta-L-threo-hexopyranoside
-
-
(3S)-3,5,12-trihydroxy-3-(hydroxyacetyl)-6,11-dioxo-1,2,3,4,5a,6,11,11a-octahydrotetracen-1-yl-3-amino-2,3,6-trideoxy-alpha-D-erythro-hexopyranoside
-
-
(3S)-3-acetyl-3,5,10-trihydroxy-6,11-dioxo-1,2,3,4,5a,6,11,11a-octahydrotetracen-1-yl-3-amino-2,3,6-trideoxy-alpha-D-erythro-hexopyranoside
-
-
(3S)-3-acetyl-3,5,12-trihydroxy-10-methoxy-6,11-dioxo-1,2,3,4,5a,6,11,11a-octahydrotetracen-1-yl-3,4-diamino-2,3,4,6-tetradeoxy-alpha-D-erythro-hexopyranoside
-
-
(3S)-3-acetyl-3,5,12-trihydroxy-10-methoxy-6,11-dioxo-1,2,3,4,5a,6,11,11a-octahydrotetracen-1-yl-3-amino-2,3,6-trideoxy-alpha-D-erythro-hexopyranoside
-
-
(3S)-3-acetyl-3,5,12-trihydroxy-10-methoxy-6,11-dioxo-1,2,3,4,5a,6,11,11a-octahydrotetracen-1-yl-4-amino-2,4,6-trideoxy-alpha-D-threo-hexopyranoside
-
-
(3S)-3-acetyl-3,5,12-trihydroxy-6,11-dioxo-1,2,3,4,5a,6,11,11a-octahydrotetracen-1-yl-2,6-dideoxy-beta-L-threo-hexopyranoside
-
-
(3S)-3-acetyl-3,5,12-trihydroxy-6,11-dioxo-1,2,3,4,5a,6,11,11a-octahydrotetracen-1-yl-3-amino-2,3,6-trideoxy-alpha-D-erythro-hexopyranoside
-
-
(7R,9R)-Idarubicin
-
-
(8S)-10-[[(2R,4R)-4-amino-6-methyltetrahydro-2H-pyran-2-yl]oxy]-6,8,11-trihydroxy-8-(hydroxyacetyl)-1-methoxy-5a,7,8,9,10,11a-hexahydrotetracene-5,12-dione
-
-
(8S)-10-[[(2S,4S,5S)-4-amino-5-iodo-6-methyltetrahydro-2H-pyran-2-yl]oxy]-6,8,11-trihydroxy-8-(hydroxyacetyl)-1-methoxy-5a,7,8,9,10,11a-hexahydrotetracene-5,12-dione
-
-
(8S)-8-acetyl-10-[[(2R,4R)-4-amino-6-methyltetrahydro-2H-pyran-2-yl]oxy]-6,8,11-trihydroxy-1-methoxy-5a,7,8,9,10,11a-hexahydrotetracene-5,12-dione
-
-
(9S)-7-[[(2R,4R)-4-amino-6-methyltetrahydro-2H-pyran-2-yl]oxy]-6,9,11-trihydroxy-9-(hydroxyacetyl)-5a,7,8,9,10,11a-hexahydrotetracene-5,12-dione
-
-
(9S)-9-acetyl-7-[[(2S,5R)-5-amino-6-methyltetrahydro-2H-pyran-2-yl]oxy]-6,9,11-trihydroxy-5a,7,8,9,10,11a-hexahydrotetracene-5,12-dione
-
-
(E)-2-(3,5-dibromo-4-methylphenylamino)-N'-(2-hydroxy-5-nitrobenzylidene)acetohydrazide
-
inhibits Lig1 and Lig3
12-(6-piperidin-1-ylhexyl)-7,12-dihydro-6H-[1]benzothiepino[5,4-b]indole
-
-
2,3-dioxo-2,3-dihydro-1H-indole-7-carboxylic acid
-
59.3% inhibition at 0.1 mM
2-[(3,5-dibromo-4-methylphenyl)amino]-N'-[(1E)-(2-hydroxy-5-nitrophenyl)methylidene]acetohydrazide
-
-
2-[(3,5-dibromo-4-methylphenyl)amino]-N'-[(1Z)-(2-hydroxy-5-nitrophenyl)methylidene]acetohydrazide
-
78.3% inhibition at 0.1 mM
3'-dATP
-
-
3-amino-2-[[(1E)-phenylmethylidene]amino]-5-sulfanylphenol
-
68.8% inhibition at 0.1 mM
3-[(4-bromophenyl)sulfonyl]-N-[2-(4-sulfamoylphenyl)ethyl]propanamide
-
53.4% inhibition at 0.1 mM
4',6-Diamidino-2-phenylindole
-
-
4-([[(4-carboxy-5-methylfuran-2-yl)methyl]sulfanyl]methyl)-5-methylfuran-2-carboxylic acid
-
91% inhibition at 0.1 mM
4-chloro-5-[(2E)-2-(4-hydroxy-3-nitrobenzylidene)hydrazinyl]pyridazin-3(2H)-one
-
specific for Lig1
4-chloro-5-[(2E)-2-[(4-hydroxy-3-nitrophenyl)methylidene]hydrazino]pyridazin-3(2H)-one
-
-
4-chloro-5-[(2Z)-2-[(4-hydroxy-3-nitrophenyl)methylidene]hydrazino]pyridazin-3(2H)-one
-
59.8% inhibition at 0.1 mM
4-demethyl-6-deoxydaunorubicin
-
-
5-(methylsulfanyl)thiophene-2-carboxylic acid
-
60.5% inhibition at 0.1 mM
6-amino-5-[[(1E)-phenylmethylidene]amino]-2-sulfanylpyrimidin-4-ol
-
-
7-(4-methoxyphenyl)pteridine-2,4-diol
-
52.5% inhibition at 0.1 mM
9-beta-D-Arabinofuranosyl-2-fluoroadenine triphosphate
-
0.08 mM, 90% inhibition
actinomycin
-
-
actinomycin
-
-
ADP
-
inhibits catalysis of nick-sealing by the ligase-AMP intermediate
aleuritolic acid
-
-
ammonium sulfate
Q50566
10 mM, 60% inhibition
AMPPNP
-
no inhibition
AMPPNP
-
nonhydrolyzable ATP analogue
Anthracycline derivatives
-
inhibit human DNA ligase I and rat DNA ligase I and III in the poly[d(A-T)] joining assay
Anthracycline derivatives
-
the inhibitors possessing a 3'-amino-4'-deoxy-sugar carrying no other modifications exhibit the most potent inhibition
apurine/apyrimidinic endonuclease I
-
inhibition if the DNA ligase I substrate has a tetrahydrofuran residue on the 5'-downstream primer of a nick, simulating a reduced abasic site
-
Arabinosyl-2-fluoro-ATP
-
-
ATP
-
inhibits the last step of the reaction, which involves cleavage of the diphosphate bond of the DNA-adenylate intermediate and phosphodiester bond formation
ATP
-
5 mM and higher. 5 mM, completely inhibits blunt end ligation, only 8% reduces ligation of cohesive DNA ends
ATP
-
2 mM 50% inhibition
ATPalphaS
-
-
Ca2+
-
CaCl2 inhibits Mg2+-catalyzed reaction
Ca2+
-
inhibition above 40 mM
Ca2+
-
partially inhibitory, ligation activity in presence of Mg2+
camptothecin
B6ZH51
-
Cd2+
-
5 mM, abolishes ligation reaction in presence of 5 mM Mg2+
CdCl2
-
0.04 mM, complete inhibition
Chelerythrine chloride
-
-
Chelerythrine chloride
-
low active inhibitor
Co2+
-
5 mM, abolishes ligation reaction in presence of 5 mM Mg2+
CTP
-
2 mM, 18% inhibition of single-turnover ligation
Cu2+
-
partially inhibitory, ligation activity in presence of Mg2+
dATP
-
competitive with respect to ATP
dATP
-
-
dATP
-
competitive with respect to ATP
diphosphate
-
-
Distamycin
-
-
Distamycin
-
and derivatives, inhibit human DNA ligase I and rat DNA ligase I and III in the poly[d(A-T)] joining assay
Doxorubicin
-
-
Doxorubicin
-
an antitumor drug, potent inhibitor
Doxorubicin
-
-
EDTA
Q976G4
-
EDTA
-
EDTA rapidly inactivates all LIG1-catalyzed reactions
Ethidium bromide
-
-
Ethidium bromide
-
-
Ethidium bromide
-
-
Fagaronine chloride
-
-
Fagaronine chloride
-
most potent inhibitor
Fulvoplumierin
-
-
GTP
-
2 mM, 38% inhibition of single-turnover ligation
K+
-
extent of inhibition varies with the terminal sequence of the duplex DNA used as substrate
K+
-
50 mM, 50% inhibition
KCl
Q9P9K9
100 mM, 85% inhibition, not inhibited below 50 mM
KCl
Q50566
50 mM, 70% inhibition
KCl
-
30 mM, more than 60% reduction in product formation
KCl
-
100 mM, approximately 70% inhibition
Mn2+
-
MnCl2 inhibits Mg2+-catalyzed reaction
myricetin
-
-
N-[5-([5-[(3-amino-3-iminopropyl)carbamoyl]-1-methyl-1H-pyrrol-3-yl]carbamoyl)-1-methyl-1H-pyrrol-3-yl]-4-(formylamino)-1-methyl-1H-pyrrole-2-carboxamide hydrochloride
-
distamycin A
N-[5-([5-[(3-amino-3-iminopropyl)carbamoyl]-1-methyl-1H-pyrrol-3-yl]carbamoyl)-1-methyl-1H-pyrrol-3-yl]-4-[([4-[bis(2-chloroethyl)amino]phenyl]carbonyl)amino]-1-methyl-1H-pyrrole-2-carboxamide hydrochloride
-
FCE-24517
Na+
-
extent of inhibition varies with the terminal sequence of the duplex DNA used as substrate. Resistance to inhibition in the order from strong to weak: HindIII, PstI, EcoRI, BamHI, SalI in cohesive end ligation, and EcoRV, ScaI, PvuII, NruI in blunt end ligation
NaCl
Q9P9K9
100 mM, 85% inhibition, not inhibited below 50 mM
NaCl
Q50566
50 mM, 75% inhibition, 80 mM, 90% inhibition
NaCl
-
above 20 mM, more than 60% reduction in product formation
NaCl
C4M5H3
complete inhibition at above 200 mM
NaCl
-
100 mM, approximately 70% inhibition
NEM
-
concentrations higher than 1 mM
NH4Cl
-
100 mM, approximately 70% inhibition
Ni2+
-
5 mM, abolishes ligation reaction in presence of 5 mM Mg2+
Nitidine chloride
-
-
Nitidine chloride
-
most potent inhibitor
oleanolic acid
-
-
p-chloromercuribenzoate
-
-
PCNA
Q976G4
inhibition of the DNA ligase I activity by proliferating cell nuclear antigen, PCNA, complexes StoPCNA. StoPCNA1 and StoPCNA3, overview
-
phosphate
-
inhibits blunt end ligation
phosphate
-
wild type enzyme activity is reduced by 4%, 35%, 73%, and 91% at 100 mM, 150 mM, 200 mM, and 250 mM phosphate, respectively
Protein inhibitor
-
inhibitor protein purified from human cells, MW 55000-75000, forms a reversible complex with DNA ligase I, but has no effect on DNA ligase II. The inhibitor may play a regulatory role for DNA replication and repair
-
Protein inhibitor
-
specific inhibitor for DNA ligase I , this protein inhibitor may play a specific role in regulating DNA ligation during replication, repair, or recombination
-
Protolichesterinic acid
-
-
pyridoxal 5'-phosphate
-
DNA ligase I
pyridoxal 5'-phosphate
-
inhibits last step of the reaction, which involves cleavage of the diphosphate bond of the DNA-adenylate intermediate and phosphodiester bond formation
Replication factor C
-
LigI interacts with and is inhibited by replication factor C
-
sanguinarine
-
low active inhibitor
Sanguinarine nitrate
-
-
spermidine
-
10 mM, inhibits joining of DNA blunt ends, no effect on the joining of cohesive termini
Swertifrancheside
-
-
Swertifrancheside
-
flavonoxanthone glucoside
ursolic acid
-
-
UTP
-
2 mM, 7% inhibition of single-turnover ligation
Zn2+
-
5 mM, abolishes ligation reaction in presence of 5 mM Mg2+
ZnCl2
-
0.8 mM, complete inhibition
[(7-chloro-4-nitro-2,1,3-benzoxadiazol-5-yl)sulfanyl]acetic acid
-
60.6% inhibition at 0.1 mM
Mn2+
-
5 mM, abolishes ligation reaction in presence of 5 mM Mg2+
additional information
-
dephosphorylation causes drastic reduction in enzyme activity
-
additional information
-
-
-
additional information
-
inhibited strongly by mismatches at the 3'-OH acceptor terminus
-
additional information
-
antibodies raised against the 130000 MW polypeptide of DNA ligase I specifically recognize this species in an immunoblot and inhibit only the activity of DNA ligase I
-
additional information
-
not inhibited by pamidronate
-
additional information
-
not inhibited by 2,4-diamino-7-dimethylamino-pyrimido[4,5-d]pyrimidine, trimethoprim, and methotrexate
-
additional information
-
not inhibited by apigenin, betulinic acid, (-)-catechin, chloroquine, chelidonine, N-demethylfagaronine, berberine, coptisine chloride, tetrahydroberberine, and tertahydropalmatine
-
additional information
Q57635
the effects of mismatches on joining short oligonucleotides by Methanocaldococcus jannaschii DNA ligase are fully characterized. The mismatches at the first position 5' to the nick inhibits ligation more than those at the first position 3' to the nick. The mismatches at other positions 5' to the nick (3rd to 7th sites) exhibits less inhibition on ligation. However, the introduction of a C/C mismatch at the third position 5' to the nick completely inhibits the ligation of the terminal-mismatched nick of an oligonucleotide duplex by the DNA ligase
-
ACTIVATING COMPOUND
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
IMAGE
apurine/apyrimidinic endonuclease I
-
stimulation of DNA ligase activity, inhibition if the DNA ligase I substrate has a tetrahydrofuran residue on the 5'-downstream primer of a nick, simulating a reduced abasic site
-
Bovine serum albumin
-
stimulates
-
dithiothreitol
-
required for optimal activity
dithiothreitol
-
required for optimal activity of DNA ligase I, but not for DNA ligase II activity
DRB0098 protein
-
DNA ligase activity of LigB is severalfold stimulated by PprA in the presence of the recombinant DRB0098 protein
-
phosphate
-
DNA ligase I is a phosphoprotein, dephosphorylation causes drastic reduction in enzyme activity
Polyamines
-
polyamines activate at suboptimal concentrations of Mg2+
-
Polyethylene glycol
-
polyethylene glycol 8000, maximal stimulation at 15%
Polyethylene glycol
-
polyethylene glycol 6000, 15%, stimulates, when NaCl and KCl are both absent. With 10% polyethylene glycol 6000, both cohesive end ligation and blunt end ligation are increased at high concentrations of salt, 150-200 mM NaCl, or 200-250 mM KCl. With 10% polyethylene glycol 6000, intermolecular and intramolecular ligation occurs at low salt concentrations, 0.1 mM NaCl or 0-150 mM KCl. Only linear oligomers are formed by intermolecular ligation at the high concentrations
polyvinyl alcohol
-
required for optimal activity of DNA ligase I but not for DNA ligase II activity
PprA protein
-
DNA ligase activity of LigB is severalfold stimulated by PprA in the presence of the recombinant DRB0098 protein
-
Proliferating cell nuclear antigen
-
5fold activation, proliferating cell nuclear antigen improves binding of DNA ligase I to ligation site and is responsible for the stable association of DNA ligase I to nicked duplex DNA
-
Proliferating cell nuclear antigen
-
-
-
Proliferating cell nuclear antigen
-
stimulatory effect of Pyrococcus furiosus proliferating cell nuclear antigen (PCNA) on the enzyme activity of Pyrococcus furiosus DNA ligase is observed not at low ionic strength, but at a high salt concentration, at which a DNA ligase alone cannot bind to a nicked DNA substrate. Identification of the amino acid residues that are critical for PCNA binding in a loop structure located in the N-terminal DNA-binding domain of Ppyrococcus furiosus DNA ligase. The pentapeptide motif QKSFF is involved in the PCNA-interacting motifs, in which Gln and the first Phe are especially important for stable binding with PCNA
-
Reducing agent
-
reducing agents, e.g. 2-mercaptoethanol or dithiothreitol required
-
Reducing agent
-
reducing agents, e.g. 2-mercaptoethanol or dithiothreitol required
-
replication protein
-
-
-
replication protein A
-
approx. 15fold stimulation of DNA ligase I
-
spermidine
-
5 mM, increases the Km for nicked DNA, increases reaction velocity
spermine
-
0.5 mM, increases the Km for nicked DNA, increases reaction velocity
T4RNA ligase
-
stimulates T4 DNA ligase activity
-
XLF-Cernunnos
-
a component of the DNA ligase IV-XRCC4 complex, which functions during DNA non-homologous end joining and stimulates ligase IV re-adenylation following ligation
-
XRCC1
-
DNA ligase III-alpha forms a complex with the DNA single-strand break repair protein XRCC1
-
XRCC4
-
stimulates DNA ligase activity primarily through direct structure interaction with DNA ligase
-
Hexamine cobalt chloride
-
maximal stimulation at 0.001-0.0015 mM, blunt end ligation is stimulated 50fold, but cohesive end ligation only 5fold
additional information
-
human fibroblast line GM1492, but not several related fibroblast lines, expresses substantial amounts of a heat-stable protease-sensitive factor, which stimulates calf thymus DNA ligase I
-
additional information
-
LigI activity is strongly linked to proliferating cell nuclear antigen, the interaction between both factors is essential for the recruitment of LigI to replication foci and sites of DNA damage, replication efficiency is reduced on CTG/CAG templates with a defective LigI
-
additional information
Q980T8
the enzyme interacts with the proliferating cell nuclear antigen heterotrimer
-
KM VALUE [mM]
SUBSTRATE
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
IMAGE
0.000029
(deoxyribonucleotide)20
-
25C, pH 7.5
-
0.00009
(dT)20
-
hybridized with (dA)
0.000001
(single-stranded DNA splinted by RNA)m
-
value below, pH 7.4, 25C
-
0.0000034
ATP
-
30C
0.0000049
ATP
-
30C, in the presence of 0.0000125 mM replication protein A
0.000064
ATP
C4M5H3
in 50 mM Tris pH 7.5, 100 mM NaCl, 10 mM dithiothreitol, at 21C
0.0002 - 0.0015
ATP
-
DNA ligase I
0.0002 - 0.0015
ATP
-
ATP
0.0003
ATP
-
ATP-diphosphate exchange reaction
0.00034
ATP
-
-
0.0004
ATP
-
25C, pH 7.5
0.0005 - 0.001
ATP
-
DNA ligase I
0.001
ATP
-
p(dT)20 annealed with poly(dA)
0.001
ATP
-
pH 7.5, 70C, synthesis of P1-(5'-adenosyl),P4-(5'-guanosyl)tetraphosphate
0.0011
ATP
Q50566
60C, pH 7.5
0.0015
ATP
-
-
0.0016
ATP
-
-
0.0016
ATP
-
DNA terminal phosphate
0.002
ATP
-
ATP, ATP-diphosphate exchange reaction; DNA ligase I
0.002
ATP
-
ATP
0.0027
ATP
-
DNA ligase I
0.003
ATP
-
-
0.003
ATP
-
37C, pH 7.5
0.006
ATP
-
joinig reaction
0.006
ATP
-
dATP; joinig reaction
0.01 - 0.1
ATP
-
DNA ligase II
0.012
ATP
-
DNA ligase II
0.012
ATP
-
at 30 mM Mg2+, pH and temperature not specified in the publication
0.014
ATP
-
joining reaction
0.0144
ATP
-
ligation of cohesive DNA
0.03
ATP
-
DNA ligase II
0.034
ATP
Q9P9K9
65C, pH 6.5, recombinant DNA-ligase, in the presence of 1mM ATP and 5 mM Mn2+
0.04
ATP
-
DNA ligase II
0.045 - 0.1
ATP
-
DNA ligase II
0.06
ATP
-
DNA ligase I
0.07
ATP
-
-
0.1 - 1
ATP
Paramecium bursaria chlorella virus
O41026
pH 7.5, 22C, wild-type, Vmax: 1.1/sec
0.34
ATP
-
ATP-dependent ligase LigB
0.08
clodronate
-
in 50 mM HEPES/KOH (pH 7.2), 1 mM dithiothreitol, 5 mM MgCl2, at 30C
0.0016
dATP
Q50566
60C, pH 7.5
0.004
dATP
-
dATP-diphosphate exchange reaction
0.004
dATP
-
ATP
4
dimethylallyl diphosphate
-
-
0.0000015
DNA
-
internal phosphomonoesters in nicked natural DNA
0.00004
DNA
-
nicked DNA, enzyme DNA ligase II
0.00011
DNA
-
nicked DNA, enzyme DNA ligase I
0.00011
DNA
-
nicked DNA 5'-phosphoryl ends
0.0002
DNA
-
nicked DNA
0.0006
DNA
-
for either the joining of oligo(dT)10 on poly(dA) or the joining of DNA fragments with a two base-pair overhang generated by a restriction enzyme
0.05
DNA
-
blunt end joining
0.73
etidronate
-
in 50 mM HEPES/KOH (pH 7.2), 1 mM dithiothreitol, 5 mM MgCl2, at 30C
0.05
farnesyl diphosphate
-
-
0.15
farnesyl triphosphate
-
-
0.21
geranyl diphosphate
-
-
0.31
geranyl triphosphate
-
-
0.4
GTP
-
pH 7.5, 70C, synthesis of P1-(5'-adenosyl),P4-(5'-guanosyl)tetraphosphate
2.3
isopentenyl diphosphate
-
-
0.63
isopentenyl triphosphate
-
-
0.0014
nicked DNA
-
80C, pH 8.0
-
0.0000026
nicked DNA substrate
-
37C, pH 8.5
-
1.3
tripolyphosphate
-
in 50 mM HEPES/KOH (pH 7.2), 1 mM dithiothreitol, 5 mM MgCl2, at 30C
0.024
methylenebisphosphonate
-
in 50 mM HEPES/KOH (pH 7.2), 1 mM dithiothreitol, 5 mM MgCl2, at 30C
additional information
additional information
-
-
-
additional information
additional information
-
KM-values as a function of 3'-base pair identity
-
additional information
additional information
-
Km-values increase by 90-100-fold for 8-oxo-7,8-dihydroguanosine/C-, 8-oxo-7,8-dihydroinosine/C-, 8-oxo-7,8-dihydroinosine/A-, and 8-oxo-7,8-dihydroadenosine/T-containing duplexes compared to that of a G/C-containing duplex. Substrates containing guanidinohydantoin/A, guanidinohydantoin/G, spiroiminodihydantoin/A, and spiroiminodihydantoin/G base pairs exhibited Km values 20-70-fold higher than that of the substrate containing a G/base pair, while the Km value for 8-oxo-7,8-dihydroguanosine/A is 5 times lower than that for G/C
-
TURNOVER NUMBER [1/s]
SUBSTRATE
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
IMAGE
0.0018
(deoxyribonucleotide)20
-
25C, pH 7.5
-
0.025
(deoxyribonucleotide)n
Q2PCE4
mutant enzyme E143L
0.048
(deoxyribonucleotide)n
Q2PCE4
mutant enzyme T491S
0.05
(deoxyribonucleotide)n
Q2PCE4
mutant enzyme D162E
0.051
(deoxyribonucleotide)n
Q2PCE4
mutant enzyme A576P; mutant enzyme N255G
0.056
(deoxyribonucleotide)n
Q2PCE4
wild type enzyme
0.008
(single-stranded DNA splinted by RNA)m
-
pH 7.4, 25C
-
0.0026
ATP
-
30C
0.012
ATP
-
30C, in the presence of 0.0000125 mM replication protein A
0.04
ATP
C4M5H3
in 50 mM Tris pH 7.5, 100 mM NaCl, 10 mM dithiothreitol, at 21C
0.74
ATP
-
at 30 mM Mg2+, pH and temperature not specified in the publication
0.0041
clodronate
-
in 50 mM HEPES/KOH (pH 7.2), 1 mM dithiothreitol, 5 mM MgCl2, at 30C
0.0492
dimethylallyl diphosphate
-
-
0.117
DNA sealing events per min
-
-
-
0.07
etidronate
-
in 50 mM HEPES/KOH (pH 7.2), 1 mM dithiothreitol, 5 mM MgCl2, at 30C
0.0028
farnesyl diphosphate
-
-
0.0349
farnesyl triphosphate
-
-
0.0008
geranyl diphosphate
-
-
0.0319
geranyl triphosphate
-
-
0.0316
isopentenyl diphosphate
-
-
0.0729
isopentenyl triphosphate
-
-
0.11
nicked DNA
-
80C, pH 8.0
-
0.0023
nicked DNA substrate
-
37C, pH 8.5
-
0.0062
tripolyphosphate
-
in 50 mM HEPES/KOH (pH 7.2), 1 mM dithiothreitol, 5 mM MgCl2, at 30C
0.0006
methylenebisphosphonate
-
in 50 mM HEPES/KOH (pH 7.2), 1 mM dithiothreitol, 5 mM MgCl2, at 30C
additional information
additional information
-
turnover numbers as a function of 3'-base pair identity
-
additional information
additional information
-
steady state experiments with a nicked substrate containing juxtaposed dC and 5'-phosphorylated dT deoxynucleotides yield kcat and kcat/Km values of 0.4/sec and 150/microM/sec, respectively. Under identical reaction conditions, turnover of an adenylylated version of this substrate yield kcat and kcat/Km values of 0.64/sec and 240 microM/sec
-
kcat/KM VALUE [1/mMs-1]
SUBSTRATE
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
IMAGE
625
ATP
C4M5H3
in 50 mM Tris pH 7.5, 100 mM NaCl, 10 mM dithiothreitol, at 21C
4
0.0123
dimethylallyl diphosphate
-
-
157
0.056
farnesyl diphosphate
-
-
171
0.232
farnesyl triphosphate
-
-
8234
0.0038
geranyl diphosphate
-
-
175
0.103
geranyl triphosphate
-
-
8877
0.0138
isopentenyl diphosphate
-
-
113
0.116
isopentenyl triphosphate
-
-
8876
Ki VALUE [mM]
INHIBITOR
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
IMAGE
IC50 VALUE [mM]
INHIBITOR
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
IMAGE
0.025
(2-hydroxyphenyl)(4-hydroxyphenyl)methanone
-
-
0.004
2,3-dioxo-2,3-dihydro-1H-indole-7-carboxylic acid
-
-
0.018
3-[(4-bromophenyl)sulfonyl]-N-[2-(4-sulfamoylphenyl)ethyl]propanamide
-
-
0.0006
4-([[(4-carboxy-5-methylfuran-2-yl)methyl]sulfanyl]methyl)-5-methylfuran-2-carboxylic acid
-
-
0.01
5-(methylsulfanyl)thiophene-2-carboxylic acid
-
-
0.025
7-(4-methoxyphenyl)pteridine-2,4-diol
-
-
0.205
aleuritolic acid
-
-
0.226
Chelerythrine chloride
-
-
0.027
Fagaronine chloride
-
-
0.357
Fulvoplumierin
-
-
0.236
morin
-
-
0.091
myricetin
-
-
0.069
Nitidine chloride
-
-
0.216
oleanolic acid
-
-
0.387
Protolichesterinic acid
-
-
0.322
sanguinarine
-
-
0.105
Swertifrancheside
-
-
0.216
ursolic acid
-
-
0.013
[(7-chloro-4-nitro-2,1,3-benzoxadiazol-5-yl)sulfanyl]acetic acid
-
-
SPECIFIC ACTIVITY [µmol/min/mg]
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
additional information
-
-
additional information
-
-
additional information
-
-
additional information
-
-
additional information
-
-
additional information
-
-
additional information
-
-
additional information
-
-
pH OPTIMUM
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
1.5 - 3
Q2PCE4
pH-optimum in vitro
5
Q2PCE4
reduction of the Fe3+ to Fe2+ results in an 80% decrease in DNA substrate binding and an increase in the pH activity optimum to 5.0
6 - 7
Q9P9K9
-
6 - 7
-
nick-joining
6.5
-
ATP-diphosphate exchange reaction
7 - 10.5
-
-
7
-
adenylyltransferase activity
7.2 - 7.5
-
-
7.2 - 7.7
-
in Tris-HCl buffer
7.2 - 7.8
-
joining of nicks in Tris-HCl buffer
7.4 - 8
-
DNA ligase I, in Tris-HCl buffer
7.4 - 8
-
DNA ligase I, in Tris-HCl buffer
7.4
-
assay at
7.5 - 8
-
joining of DNA
7.5
-
assay at
7.5
-
optimum for nick-closing activity
7.5
Paramecium bursaria chlorella virus
O41026
assay at
7.5
-
assay at
7.8 - 8.1
-
DNA ligase II
7.8
-
-
7.8
-
DNA ligase II
8 - 8.5
-
DNA ligase I
8
Q976G4
assay at
pH RANGE
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
1.5 - 5
Q2PCE4
ligation activities, at 40C under conditions of substrate saturation, are highest at pH 2.5-3.0, only slightly lower at pH 1.5-2.0 (about 80%) and are practically undetectable above pH 5.0
5 - 8.5
-
pH 5.0: about 65% of maximal activity, pH 8.5: about 45% of maximal activity, adenylyltransferase activity
6.5 - 8.5
-
pH 6.5: about 80% of maximal activity, pH 8.5: about 85% of maximal activity
6.5 - 8.5
C4M5H3
DNAligI activity gradually increases from pH 6.5 to 8.0 and displays a sharp decline at pH 8.5
6.5 - 9
Q50566
approx. 20% of maximal activity at pH 6.5, approx. 90% of maximal activity at pH 9.0
6.9 - 8
-
6.9: 46% of maximal activity, 8.0: 65% of maximal activity
6.9 - 8.3
-
6.9: 40% of maximal activity, 8.3: 65% of maximal activity, joing of DNA
7 - 8.2
-
80% of maximal activity is observed between pH 7.0 and 8.2
7 - 8.5
-
approximately 70% of maximal activity at pH 7.0 and 8.5
7.2 - 8.4
-
7.2-7.7: maximal activity, 8.4: 50% of maximal activity
7.5 - 9.5
-
pH 7.5: about 40% of maximal activity, pH 9.5: about 40% of maximal activity
TEMPERATURE OPTIMUM
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
4
-
ligation of cohesive ends
10 - 16
-
when polyethylene glycol is not present
22
Paramecium bursaria chlorella virus
O41026
assay at
25 - 30
-
-
25
-
blunt end ligation, 16mer or longer; joining of the blunt ends of duplex structures 16 nucleotides or longer
25
-
assay at
37
-
sealing nicks
37
-
with 10% polyethylene glycol 6000 intermolecular ligation at high concentrations of salt is stimulated by raising the temperature from 19C to 37C
50 - 80
-
the enzyme displayed relative high activity
60 - 80
Q9P9K9
-
60
Q976G4
assay at
60
-
assay at
65 - 70
-
-
65
Q9HHC4
at 0.00002 mM ligTK
65
-
assay at
70 - 80
Q9HHC4
at 0.0002 mM ligTK
70
-
optimum for nick-closing activity is above 70C
80
-
ligation reaction
90
-
adenylyltransferase activity
TEMPERATURE RANGE
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
20 - 37
-
20C: 55% of maximal activity, 37C: about 70% of maximal activity
22 - 80
Q50566
almost no activity at 22C, approx. 25% of maximal activity at 40C and 70C
25 - 40
-
about 50% of maximal activity at 25C and at 40C
30 - 100
Q9HHC4
at 0.0002 mM ligTK
35 - 80
Q9HHC4
at 0.00002 mM ligTK
37 - 60
Q57635
ligation activity at temperatures ranging from 37C to 60C
45 - 90
Q9P9K9
-
50 - 75
-
the enzyme remains active at 50-75C or higher
60 - 90
-
60C: about 35% of maximal activity, 90C: about 90% of maximal activity, ligation activity
65 - 80
-
in the nick-closing assay, the recombinant ligase shows more than 80% activity in the temperature range 65-80C. Ligase activity declines at temperatures below 35C. A drastic decrease in activity is observed between 80 and 90C
pI VALUE
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
5.14
-
calculation from amino acid sequence
5.86
Q9P9K9
deduced from nucleotide sequence
SOURCE TISSUE
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
SOURCE
-
studies carried out in thymidine kinase 1-deficient human osteosarcoma cell line (143B [TK-])
Manually annotated by BRENDA team
-
the cell line is characterized by drastically reduced replicative DNA ligase I activity
Manually annotated by BRENDA team
-
chicken B-cell system DT40 is used
Manually annotated by BRENDA team
-
chicken B-cell line DT40 is used
Manually annotated by BRENDA team
-
LIG k alpha localizes to the kinetoplast primarily in cells that have completed mitosis and contain either a dividing kinetoplast or two newly divided kinetoplasts. The ligase is present on both faces of the kDNA disk and at a high level in the kinetoflagellar zone of the mitochondrial matrix. LIG k alpha transcript levels are maximal during the phase when cells contain two nuclei
Manually annotated by BRENDA team
-
infected with SV40 or treated with mitomycin C
Manually annotated by BRENDA team
-
10fold lower activity in adult tissues than in eggs
Manually annotated by BRENDA team
-
unfertilized, high activity of DNA ligase
Manually annotated by BRENDA team
-
unfertilized, high activity of DNA ligase
Manually annotated by BRENDA team
Pleurodeles sp., Ambystoma mexicanum
-
unfertilized, high activity of DNA ligase
Manually annotated by BRENDA team
-
heteroploid
Manually annotated by BRENDA team
-
male meiotic cell, ligase III-beta is expressed only in male meiotic germ cells
Manually annotated by BRENDA team
-
introduction of DNA lesions in human cells by laser microirradiation. DNA ligase I and III accumulate at DNA repair sites. DNA Ligase III accumulates at microirradiated sites before DNA ligase I. Recruitment of DNA ligase I to sites of DNA damage depends on its interaction with PCNA
Manually annotated by BRENDA team
-
adenovirus type 2-infected
Manually annotated by BRENDA team
-
regenerating
Manually annotated by BRENDA team
-
activity is much lower in resting lymphocytes than in actively growing cells
Manually annotated by BRENDA team
-
cell lines NGP and SK-N-Be
Manually annotated by BRENDA team
-
aging neurons are unable to affect base excision repair due to deficiency of DNA-ligase and DNA polymerase beta
Manually annotated by BRENDA team
-
highest activity
Manually annotated by BRENDA team
-
highest activity
Manually annotated by BRENDA team
-
premeiotic, high activity
Manually annotated by BRENDA team
-
DNA ligase III
Manually annotated by BRENDA team
Entamoeba histolytica HM1:IMSS
-
-
-
Manually annotated by BRENDA team
additional information
-
DNA ligase I correlates well with changes in DNA replication during development, the level of DNA ligase II activity does not change significantly between different developmental stages
Manually annotated by BRENDA team
additional information
-
LIG1 is expressed in all vegetative and reproductive tissues
Manually annotated by BRENDA team
LOCALIZATION
ORGANISM
UNIPROT
COMMENTARY
GeneOntology No.
LITERATURE
SOURCE
Entamoeba histolytica HM1:IMSS
-
-
-
Manually annotated by BRENDA team
-
LIG k alpha localizes to the kinetoplast primarily in cells that have completed mitosis and contain either a dividing kinetoplast or two newly divided kinetoplasts. The ligase is present on both faces of the kDNA disk and at a high level in the kinetoflagellar zone of the mitochondrial matrix
Manually annotated by BRENDA team
-
DNA ligase II is more firmly retained in isolated cell nuclei than DNA ligase I
Manually annotated by BRENDA team
-
DNA ligase I, II and III. DNA ligase I is more firmly associated with the nucleus than DNA ligase I. DNA ligase III is associated with the condensed chromatin that is present from anaphase to telophase
Manually annotated by BRENDA team
-
localized to granular-like foci within the nucleus during S-phase
Manually annotated by BRENDA team
C4M5H3
a population of the DNAligI protein is translocated from the cytoplasm into the nuclei
Manually annotated by BRENDA team
Entamoeba histolytica HM1:IMSS
-
a population of the DNAligI protein is translocated from the cytoplasm into the nuclei
-
Manually annotated by BRENDA team
PDB
SCOP
CATH
ORGANISM
Archaeoglobus fulgidus (strain ATCC 49558 / VC-16 / DSM 4304 / JCM 9628 / NBRC 100126)
Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Sulfolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Sulfolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Thermococcus sibiricus (strain MM 739 / DSM 12597)
MOLECULAR WEIGHT
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
31000 - 32000
-
analytical ultracentrifugation
650253
31540
-
gel filtration after preincubation with Mg2+ and diphosphate
650253
41000
-
equilibrium sedimentation
1946
41000
-
-
652785
52100
Q9HHC4
gel filtration
651669
61000
-
enzyme-adenylate complex
1906
62000
Q9P9K9
gel filtration
651216
63000
-
SDS-PAGE
690511
68000
-
gel filtration
1909, 1910
68000
-
sucrose density gradient centrifugation
1915
68000
Q50566
zonal velocity sedimentation
653383
68000
-
SDS-PAGE
727438
70000
-
gel filtration
727504
79800
-
gel filtration
1914
80000
-
gel filtration
1918
80000
-
gel filtration, glycerol density gradient sedimentation
1930
82000
-
gel filtration
1923
85000
-
gel filtration
1909
85000
-
and a higher MW form of MW 175000, gel filtration, sucrose density gradient centrifugation
1927
90000
-
gel filtration
1943
95000
-
DNA ligase II, gel filtration
1926
98000
-
hydrodynamic measurements
1968
100000
-
gel filtration
1925
100000
-
gel filtration
1945
100000
-
-
1945
100000
-
novel enzyme form different from DNA ligase I
1961
102000
-
sucrose density gradient centrifugation
1906
105000
-
glycerol density gradient sedimentation
1922
120000 - 130000
-
sucrose density gradient centrifugation, highly asymetric shape
1920
130000
-
gel filtration
1912
160000
-
-
1906
175000
-
DNA ligase I, gel filtration, sucrose density gradient centrifugation
1927
180000
Pleurodeles sp., Xenopus laevis
-
-
1906
190000
-
and a lower MW form of MW 95000, gel filtration
1926
200000
-
gel filtration
1909
240000
-
gel filtration
1917
additional information
-
DNA ligase I, and II have a markedly asymetric structure, gel filtration data lead to a gross overestimation of the MW
1906
SUBUNITS
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
?
-
1 * 130000, SDS-PAGE
?
Lymantria dispar multicapsid nucleopolyhedrovirus
Q9YMV2
x * 62000, SDS-PAGE
?
Q08387
x * 90000, SDS-PAGE
?
-
x * 180000, SDS-PAGE
?
-
x * 83000-86000, SDS-PAGE
?
-
x * 44000, DNA ligase V, SDS-PAGE
?
-
x * 120000-130000, SDS-PAGE, gel filtration under denaturing conditions, DNA ligase I
?
-
x * 85000, calculation from nucleotide sequence, SDS-PAGE
?
-
x * 125000, SDS-PAGE, gel filtration under denaturing conditions
?
-
x * 120000, SDS-PAGE
?
-
x * 125000, denaturing PAGE
?
-
x * 86000, calculation from nucleotide sequence, SDS-PAGE
?
-
x * 110000, SDS-PAGE
?
C4M5H3
x * 75000, SDS-PAGE
?
-
x * 87000, SDS-PAGE
?
Q08387
x * 104000, deduced from nucleotide sequence
?
-
x * 67800, calculation from sequence
?
-
x * about 100000, SDS-PAGE
?
Entamoeba histolytica HM1:IMSS
-
x * 75000, SDS-PAGE
-
dimer
-
1 * 46000 + 1 * 100000, DNA ligase III, SDS-PAGE. It cannot be concluded whether the 46000 MW peptide is an essential and integral part of DNA ligase III, or if it represents a separate protein that binds tentaciously to the 100000 MW DNA ligase component
homodimer
-
x-ray crystallography
monomer
-
-
monomer
-
-
monomer
-
1 * 69000, SDS-PAGE
monomer
-
x * 80000, SDS-PAGE
monomer
-
1 * 68000, SDS-PAGE
monomer
Q50566
1 * 68000, SDS-PAGE
monomer
-
1 * 95000, DNA ligase I, SDS-PAGE
monomer
-
x * 100000, DNA ligase II, SDS-PAGE
monomer
-
1 * 88000, SDS-PAGE
monomer
-
1 * 63000, PAGE under denaturing and reducing conditions
monomer
-
1 * 41000, SDS-PAGE
monomer
-
1 * 65000, DNA ligase II, SDS-PAGE
monomer
-
1 * 84406, calculation from nucleotide sequence
monomer
-
1 * 68000-72000, DNA ligase II, SDS-PAGE, 1 * 125000-130000, DNA ligase I, SDS-PAGE
monomer
-
1 * 83000, SDS-PAGE
monomer
-
1 * 100000
monomer
-
1 * 31548, deduced from nucleotide sequence, 1 * 31873, mass spectroscopy
monomer
Q9HHC4
1 * 64079, deduced from nucleotide sequence
monomer
Q9P9K9
1 * 67647, deduced from nucleotide sequence
monomer
-
ATP-dependent ligase LigB, ATP-dependent ligase LigC, ATP-dependent ligase LigD
monomer
-
1 * 69196, the authors refer to the protein of 619 amino acids that is later reannotated as a protein of 602 amino acids (67747.6 Da), calculated from sequence
monomer
Aeropyrum pernix DSM 11879
-
1 * 69000, SDS-PAGE, 1 * 69196, the authors refer to the protein of 619 amino acids that is later reannotated as a protein of 602 amino acids (67747.6 Da), calculated from sequence
-
additional information
-
298 amino acid Chlorella virus PBCV-1 ligase is the smallest eukaryotic DNA ligase known
additional information
-
AtuLigD1 consists of a central ATP-dependent ligase domain fused to an N-terminal phosphoesterase module and a C-terminal polymerase-like domain
POSTTRANSLATIONAL MODIFICATION
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
phosphoprotein
-
phosphorylation of human DNA ligase I regulates its interaction with replication factor C and its participation in DNA replication and DNA repair
Crystallization/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
ATP-dependent DNA ligase in the DNA-unbound unadenylated state, hanging drop vapor diffusion method, using 100 mM Tris-HCl pH 9.0, 0.4 M sodium dihydrogen phosphate, 1.2 M dipotassium hydrogen phosphate, and 10 mM magnesium chloride, at 4C
O29632
2.0 A crystal structure of D29A mutant complexed with AMP
-
crystal structure of human DNA ligase I bound to nicked, 5'-adenylated DNA. The crystal structure of human DNA ligase I complexed to DNA demonstrates that the enzyme encircles its DNA substrate
-
in complex with the AMP-DNA reaction intermediate
-
LigIII in complex with 22-mer nicked DNA, hanging drop vapor diffusion method, using 1.8 M ammonium sulfate and 0.1 M sodium acetate (pH 5.6)
-
LigIV in complex with XRCC4
-
X1BRCTb complexed with L3BRCT
-
the C-terminal ligase domain of selenomethioninyl-substituted MtuLigD is crystallized by vapor diffusion using a precipitant solution containing PEG-3000 and ZnCl2. Crystals belonged to the space group P3(2)21 (a = b = 57.1 A, c = 369.0 A). 2.4 A crystal structure of the ligase domain of Mycobacterium LigD, captured as the covalent ligase-AMP intermediate with a divalent metal in the active site
-
1.8 A resolution structure of Pyrococcus furiosus DNA ligase. The enzyme comprises the N-terminal DNA binding domain, the middle adenylation domain, and the C-terminal OB-fold domain. The architecture of each domain resembles those of human DNA ligase I, but the domain arrangements differ strikingly between the two enzymes
-
hanging-drop vapour diffusion method, crystals of the archaeal DNA ligase from Pyrococcus furiosus aree obtained using 6.6%(v/v) ethanol as a precipitant and diffracted X-rays to 1.7 A resolution. They belong to the monoclinic space group P2(1), with unit-cell parameters a = 61.1, b = 88.3, c = 63.4 A, beta = 108.9. The asymmetric unit contains one ligase molecule
-
in complex with the AMP-DNA reaction intermediate
-
co-crystal structure of yeast PCNA with a peptide encompassing the conserved PCNA interaction motif of Cdc9 (DNA ligase I). The Cdc9 peptide contacts both the inter-domain connector loop and residues near the C-terminus of PCNA. The C-terminal domain of yeast PCNA is required for physical and functional interactions with Cdc9 DNA ligase
-
hanging-drop vapor diffusion, crystal structures in conjunction with solution structures of these proteins based on small-angle X-ray scattering. In the absence of nicked DNA, the Sulfolobus solfataricus DNA ligase has an open, extended conformation. When complexed with heterotrimeric proliferating cell nuclear antigen, the DNA ligase binds to the proliferating cell nuclear antigen 3 subunit and ligase retain an open, extended conformation
Q980T8
in complex with the AMP-DNA reaction intermediate
-
hanging drop vapor diffusion method, using 35% (v/v) tacsimate pH 7.0 as a precipitant
-
results of a crystallographic study of the ATP-dependent DNA ligase from Thermococcus sp. 1519 with all three domains (N-terminal DNA-binding domain (DBD), an adenylation domain (AdD) and a C-terminal OB-fold domain (OBD)) are reported
C0LJI8
pH STABILITY
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
2 - 3
Q2PCE4
LigFa is acid-tolerant and retains about 95% of its activity after incubation at pH 2.0-3.0 for 10 h but is unstable at higher pH levels
694908
TEMPERATURE STABILITY
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
4
-
14 days, autoproteolysis is observed
1911
37
-
24 h, autoproteolysis is observed
1911
37
-
significant loss of ligation activity
650937
38
-
inactivation temperature, Q10: 2.3
1919
40
-
DNA ligase II, rapid loss of activity above
1927
42
-
-
1906
42
-
rapid inactivation, DNA ligase II
1906
42
-
DNA ligase II, 5 min, 50% inactivation
1927
50
-
DNA ligase I is stable to prolonged heating
1927
52
-
DNA ligase I, 5 min, 50% inactivation
1927
80
Q9P9K9
15% loss of activity after 5 h
651216
80
-
more than 50% Lig1519 activity is preserved after incubation of the enzyme at 80C for 30 min
690511
80
-
5 h, about 5% loss of activity, lysate of cell harbouring with recombinant JP2 ligase gene
726420
85
Q9P9K9
29% loss of activity after 5 h
651216
85
-
5 h, about 10% loss of activity, lysate of cell harbouring with recombinant JP2 ligase gene
726420
90
Q9P9K9
50% loss of activity after approx. 10 min
651216
90
-
1 h, about 55% loss of activity, lysate of cell harbouring with recombinant JP2 ligase gene
726420
90
Q57635
20 min, about 20% loss of activity
728739
94
-
Hbu DNA ligase exhibits about 50% of the original activity for 2.3 h at temperatures up to 94 C
727438
95
-
10 min, about 80% loss of activity, lysate of cell harbouring with recombinant JP2 ligase gene
726420
99
-
Hbu DNA ligase exhibtis a 1.7 h half life at 99 C
727438
100
-
the half-life of heat inactivation at 100C is about 5 min
694991
100
-
stable for 60 min, half-life: 25 min
727504
GENERAL STABILITY
ORGANISM
UNIPROT
LITERATURE
retains 90% of its activity after 3 cycles of freeze-thawing
-
very susceptible to proteolysis
-
a 10 U/ml dilution loses 40% of its activity in 3 months
-
T4 DNA ligase gradually lose their activity when incubated at temperatures above 0C
-
DNA ligase IV depends on the partner protein XRCC4 for stability and activity
-
DNA ligase I is highly sensitive to partial proteolysis
-
Tween 20, 0.2% or bovine serum albumin stabilizes
-
Lig3 stability depends upon its nuclear binding partner Xrcc1
-
ORGANIC SOLVENT
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
formamide
Q976G4
inactivation at about 50%
formamide
Sulfolobus tokodaii 7
-
inactivation at about 50%
-
STORAGE STABILITY
ORGANISM
UNIPROT
LITERATURE
-70C, stable for at least 2 months
-
-80C, stable
-
-80C, stable for at least 12 months
-
0C, stable for at least 6 months
-
-20C, high concentrations of enzyme are very stable
-
-20C, storage below -20C is detrimental
-
-20C, 50% glycerol w/w, 3 mg/ml bovine serum albumin, stable for up to 7 months
-
-20C, saturated ammonium sulfate solution buffered at pH 7.5, stable for several months
-
Purification/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
recombinant intein-DNA ligase I fusion protein, chitin beads, Affi Gel Blue
-
Ni-NTA agarose column chromatography, Source 15Q ion-exchange column chromatography, and Superdex-200 gel filtration
O29632
DNA ligase I
-
DNA ligase II
-
DNA ligase III
-
Co2+ affinity column chromatography and Sepacryl S-100 gel filtration
-
Ni-agarose column chromatography and phosphocellulose column chromatography
-
nickel-agarose column chromatography and phosphocellulose column chromatography
-
recombinant DNA ligase
-
DNA ligase I
-
partial, hemagglutinin-tagged DNA ligase
Q53E05
DNA ligase I, DNA ligase II partial; DNA ligase II
-
DNA ligase II
-
HiTrap column chromatography and phosphocellulose column chromatography
C4M5H3
recombinant polyhistidine-tagged enzyme
-
Sepharose column chromatography and hydroxyapatite column chromatography
-
recombinant domain 1, i.e. residues 1-240 and domain 2, i.e. residues 241-359
-
Resource Q column chromatography and Superdex-200 gel filtration
Q2PCE4
DNA ligase V
-
HiTrap nickel chelating column chromatography and Sephadex S200 gel filtration
-
immobilized metal affinity column chromatography and Superdex S75 gel filtration
-
multienzyme complex consisting of DNA polymerase alpha-primase, a 3',5'-exonuclease, DNA ligase I, RNase H, and topoisomerase I
-
Ni-NTA column chromatography and Q-Sepharose column chromatography
-
nickel-agarose bead chromatography, ion exchange chromatography, and gel filtration
-
recombinant DNA ligase I
-
recombinant DNA ligase III
-
recombinant DNA ligase IV-XRCC4 complex, metal-chelate Talon affinity resin, Mono Q
-
Sepharose column chromatography and hydroxyapatite column chromatography
-
Sepharose column chromatography, Source Q column chromatography, and Superdex 200 gel filtration
-
wild-type and mutant DNA ligase IV/Xrrc4 complexes
-
purified using the IMPACTTM-CN system (intein-mediated purification with an affinity chitin-binding tag) and cation-ion (Arg-tag) chromatography
-
recombinant his-tagged DNA ligase
Lymantria dispar multicapsid nucleopolyhedrovirus
Q9YMV2
DNA ligase I and II
-
DNA ligase I, II, III, and IV
-
recombinant Mth ligase
Q50566
DNA ligase I and II
-
His10-LigB fusion protein expressed in Escherichia coli; His10-LigC fusion protein expressed in Escherichia coli; His10-LigD fusion protein expressed in Escherichia coli
-
separate polymerase, nuclease and ligase domains of Mt-Lig cloned individually and over-expressed in Escherichia coli B834
-
recombinant his-tagged ADL, nickel-affinity chromatography
-
using Ni-NTA chromatography
Paramecium bursaria chlorella virus
O41026
-
Pleurodeles sp.
-
nickel agarose column chromatography
-
DNA ligase I and II
-
hydroxyapatite column, partially purified
Q08387
purification of recombinant DNA ligase, partially purification of native DNA ligase
Q9P9K9
recombinant His-tagged DNA ligase I from Escherichia coli strain BL21(DE3) by nickel affinity chromatography and gel filtration
Q976G4
recombinant ligTK, ResourceQ, ResourceS, Superdex-200
Q9HHC4
Ni-NTA column chromatography
-
Ni-Sepharose column chromatography, Mono beads Q column chromatography, and Superdex 200 gel filtration
-
DNA ligase II
-
Cloned/COMMENTARY
ORGANISM
UNIPROT
LITERATURE
expression in Escherichia coli
Q9YD18
expression of intein-DNA ligase I fusion protein in Escherichia coli
-
expressed in Escherichia coli Rosetta2(DE3)pLysS cells
O29632
expressed in Escherichia coli BL21(DE3) cells
-
expression in Escherichia coli
-
expression of hemagglutinin-tagged DNA ligase in Crithidia fasciculata
Q53E05
expressed in Escherichia coli
-
expressed in Escherichia coli BL21-Start cells
C4M5H3
expression in Escherichia coli, polyhistidine-tagged enzyme
-
expressed in Escherichia coli BL21(DE3)pLysS cells
-
expression of domain 1, i.e. residues 1-240 and domain 2, i.e. residues 241-359 in Escherichia coli
-
gene sequence encoding FaLig is cloned into a bacterial expression vector harbouring an upstream His-tag to aid purification and expressed in Escherichia coli
-
expressed in Escherichia coli strain ORIGAMI(DE3)pLysS
Q2PCE4
expression in Escherichia coli BL21
-
amino acid sequence of human DNA ligase I and enzyme from Schizosaccharomyces pombe are virtually identical in the region of the active site, although the two enzymes show only 44% overall identity. The sequence of DNA ligase II appears to be quite different from that of DNA ligase I
-
coexpression of DNA ligase IV-XRCC4 complex in Sf9 insect cells
-
DNA ligase I, III-alpha, III-beta, IV
-
DNA ligase II and IV. DNA ligase III and IV are encoded by distinct genes located on human chromosome 17q11.2-12 and 13q33-34
-
Escherichia coli-based coexpression system provides relatively high yields of the ligase IV/XRCC4 complex
P49917
expressed as His6-tagged protein in Escherichia coli
-
expressed in Escherichia coli
-
expressed in Escherichia coli and in Sf9 insect cells
-
expressed in Escherichia coli BL21 (DE3) cells
-
expressed in Escherichia coli BL21(DE3) cells
-
expressed in Escherichia coli BL21-DE3-RIL cells
-
expression in Saccharomyces cerevisiae
-
expression in Sf9 insect cells
-
expression of wild-type and mutant Xrcc4/DNA ligase IV complexes in insect cells
-
overexpression in Spodoptera frugiperda Sf9 insect cells infected with the recombinant baculovirus
-
the catalytic domain of human LIG1 (residues 232-919) is expressed in Escherichia coli
-
Hbu DNA ligase gene is expressed under control of the T7lac promoter of pTARG in Escherichia coli BL21-Codon-Plus(DE3)-RIL
-
in vitro transcription/translation, expression in Escherichia coli
Lymantria dispar multicapsid nucleopolyhedrovirus
Q9YMV2
expression in Escherichia coli
Q50566
ATP-dependent ligase LigB is produced in Escherichia coli as a His10-LigB fusion protein; ATP-dependent ligase LigC is produced in Escherichia coli as a His10-LigC fusion protein; ATP-dependent ligase LigD is produced in Escherichia coli as a His10-LigD fusion protein
-
expressed in Escherichia coli BW23474 cells
-
separate polymerase, nuclease and ligase domains of Mt-Lig are cloned individually, over-expressed in Escherichia coli B834
-
expression in Escherichia coli
-
expressed in Escherichia coli as a His-tagged fusion protein
Paramecium bursaria chlorella virus
O41026
expressed in Escherichia coli as His-tagged enzyme
-
expression in Escherichia coli
-
overexpression of wild-type and mutant enzymes in Escherichia coli
-
in vitro transcription and translation
Q08387
expression in Escherichia coli
Q9P9K9
expression in Escherichia coli
Q980T8
expression of His-tagged DNA ligase I in Escherichia coli strain BL21(DE3)
Q976G4
expression in Escherichia coli
-
expressed in Escherichia coli DLT1270/pRARE-2 cells
-
expressed in Escherichia coli strain DLT1270/pRARE
-
EXPRESSION
ORGANISM
UNIPROT
LITERATURE
ectopic overexpression of competing LigIV fragments downregulates endogenous LigIV protein
-
LigD protein is only expressed when 0.2% L-arabinose is added to the culture
-
ENGINEERING
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
F115A
-
the ApeLig gene is originally annotated as a protein of 619 amino acids, with a calculated mass of 69196.2 Da. Later it was reannotated as a protein of 602 amino acids (67747.6 Da), in which 17 amino acids are truncated from the N-terminus of the originally annotated protein. The authors of this reference refer to the 619 amino acid protein containing the mutation at position F132. According to the UniProt numbering the position of this mutation is 115. Surface plasmon resonance analyses reveals that the F132A mutant does not interact with an immobilized subunit of the proliferating cell nuclear antigen (which is known as a DNA sliding clamp that acts as a platform for the assembly of enzymes involved in DNA replication and repair). No stimulation of the ligation activity of the F132A protein by the proliferating cell nuclear antigen can be detected in vitro. These results indicate that the phenylalanine, which is located the predicted proliferating cell nuclear antigen-binding region in the ligase, has a critical role for the physical and functional interaction with proliferating cell nuclear antigen
F115A
Aeropyrum pernix DSM 11879
-
the ApeLig gene is originally annotated as a protein of 619 amino acids, with a calculated mass of 69196.2 Da. Later it was reannotated as a protein of 602 amino acids (67747.6 Da), in which 17 amino acids are truncated from the N-terminus of the originally annotated protein. The authors of this reference refer to the 619 amino acid protein containing the mutation at position F132. According to the UniProt numbering the position of this mutation is 115. Surface plasmon resonance analyses reveals that the F132A mutant does not interact with an immobilized subunit of the proliferating cell nuclear antigen (which is known as a DNA sliding clamp that acts as a platform for the assembly of enzymes involved in DNA replication and repair). No stimulation of the ligation activity of the F132A protein by the proliferating cell nuclear antigen can be detected in vitro. These results indicate that the phenylalanine, which is located the predicted proliferating cell nuclear antigen-binding region in the ligase, has a critical role for the physical and functional interaction with proliferating cell nuclear antigen
-
Cdel5
-
mutant lacking the C-terminal pentapeptide HEEDR of motif VI, 1% of wild-type DNA ligase activity
D297A
-
14% of wild-type DNA ligase activity
D29A
-
crystal structure
E295A
-
90% of wild-type DNA ligase activity
E296A
-
52% of wild-type DNA ligase activity
F190A
-
the mutant has 31% of wild type nick sealing activity
F215A
-
the mutant has 70% of wild type nick sealing activity
F215L
-
the mutant has 75% of wild type nick sealing activity
F276A/M278A
-
the mutant has 42% of wild type nick sealing activity
F286A
-
13% of wild-type DNA ligase activity
F286A
-
the mutant has 4% of wild type nick sealing activity
F286L
-
the mutant has 61% of wild type nick sealing activity
F289A
-
42% of wild-type DNA ligase activity
H294A
-
92% of wild-type DNA ligase activity
K274A
-
the mutant has 34% of wild type nick sealing activity
K274Q
-
the mutant has 72% of wild type nick sealing activity
K274R
-
the mutant has 67% of wild type nick sealing activity
K27A
-
the mutant cannot form the covalent ligase-adenylate intermediate and hence cannot form DNA-adenylate, but retains the ability to seal a preadenylylated nick
K281A/C283A
-
the mutant has 73% of wild type nick sealing activity
K29A
-
arrests ligation reaction at the substrate adenylation step
N214A
-
the mutant has 51% of wild type nick sealing activity
N214D
-
the mutant has 94% of wild type nick sealing activity
N214L
-
the mutant has 113% of wild type nick sealing activity
N214Q
-
the mutant has 98% of wild type nick sealing activity
P284A
-
53% of wild-type DNA ligase activity
P287A
-
59% of wild-type DNA ligase activity
R285A
-
26% of wild-type DNA ligase activity
R285A
-
the mutant has 7% of wild type nick sealing activity
R285K
-
the mutant has 6% of wild type nick sealing activity
R285Q
-
the mutant has 8% of wild type nick sealing activity
R293A
-
30% of wild-type DNA ligase activity
R298A
-
85% of wild-type DNA ligase activity
S218A/R220A
-
the mutant has 49% of wild type nick sealing activity
S221A/T222A/H223A
-
the mutant has 42% of wild type nick sealing activity
S235A
-
the mutant has 112% of wild type nick sealing activity
S235A/K281A/C283A
-
the mutant has 49% of wild type nick sealing activity
T249A
-
the mutant has 92% of wild type nick sealing activity
V288A
-
the mutant has 58% of wild type nick sealing activity
V288I
-
the mutant has 91% of wild type nick sealing activity
V288T
-
the mutant has 74% of wild type nick sealing activity
Y217A
-
the mutant has 44% of wild type nick sealing activity
Y217F
-
the mutant has 112% of wild type nick sealing activity
Y217L
-
the mutant has 84% of wild type nick sealing activity
Y217S
-
the mutant has 85% of wild type nick sealing activity
K326
C4M5H3
catalytically inactive
K326
Entamoeba histolytica HM1:IMSS
-
catalytically inactive
-
K159L
-
the inactive His-K159L substitution mutant is unable to self-associate, but still possesses AMP-dependent DNA nicking activity, no blunt end ligation. Mutant enzyme His-N-DELTA80 catalyzes no blunt end ligation and no AMP-dependent activity. Mutant enzyme His-C-DELTA57has no blunt end ligation activity, no AMP-dependent activity, low nick joining activity and low ATP binding. Mutant enzyme His-K159L has no blunt end ligation activity, no nick joining activity, no ATP binding, no DNA binding, and no AMP-dependent activity
K159L
-
adenylation site mutant, aboragates the ability of the ligase to covalently link to an AMP moiety
A576P
Q2PCE4
the mutation hardly affects ligation activity at pH 3.0
D162E
Q2PCE4
the mutation hardly affects ligation activity at pH 3.0
E134L
Q2PCE4
the mutation causes a 60% reduction at pH 3.0, with no net change in iron content and purple color, the mutant has an activity optimum of pH 5.0 and a 1.5fold higher turnover number as the wild type enzyme
N255G
Q2PCE4
the mutation hardly affects ligation activity at pH 3.0
T491S
Q2PCE4
the mutation hardly affects ligation activity at pH 3.0
A576P
Ferroplasma acidiphilum YT
-
the mutation hardly affects ligation activity at pH 3.0
-
D162E
Ferroplasma acidiphilum YT
-
the mutation hardly affects ligation activity at pH 3.0
-
E134L
Ferroplasma acidiphilum YT
-
the mutation causes a 60% reduction at pH 3.0, with no net change in iron content and purple color, the mutant has an activity optimum of pH 5.0 and a 1.5fold higher turnover number as the wild type enzyme
-
N255G
Ferroplasma acidiphilum YT
-
the mutation hardly affects ligation activity at pH 3.0
-
T491S
Ferroplasma acidiphilum YT
-
the mutation hardly affects ligation activity at pH 3.0
-
F717L
-
amino acid substitution within the conserved peptide of DNA ligase IIIbeta, does not complement Escherichia coli lig mutant
G468A
-
mutant enzyme shows residual adenylate complex formation at high protein concentrations, mutant complex has a lower affinity for ATP compared to wild-type complex
G468E
-
mutant DNA ligase IV/Xrrc4 complex is poorly expressed, mutation completely abolishes adenylate complex formation, mutant complex has no ligation activity
G469A
-
mutant enzyme shows residual adenylate complex formation
G469E
-
mutant DNA ligase IV/Xrrc4 complex is poorly expressed, mutation completely abolishes adenylate complex formation, mutant complex has no ligation activity
G712A
-
amino acid substitution within the conserved peptide of DNA ligase IIIbeta, complements Escherichia coli lig mutant
K323E
-
the mutant has significantly reduced blunt end DNA ligation activity (87% decrease in the initial velocity of blunt end DNA ligation compared to wild type enzyme), but has very little effect on DNA nick joining activity, the mutation selectively blocks zinc finger function
K323E/E265K
-
the mutations do not restore efficient blunt end DNA joining activity
K724E
-
amino acid substitution within the conserved peptide of DNA ligase IIIbeta, does not complement Escherichia coli lig mutant
K727G
-
amino acid substitution within the conserved peptide of DNA ligase IIIbeta, does not complement Escherichia coli lig mutant
P718A
-
amino acid substitution within the conserved peptide of DNA ligase IIIbeta, complements Escherichia coli lig mutant
P718T
-
amino acid substitution within the conserved peptide of DNA ligase IIIbeta, complements Escherichia coli lig mutant
p719G
-
amino acid substitution within the conserved peptide of DNA ligase IIIbeta, does not complement Escherichia coli lig mutant, thermolabile mutant
R278H
-
the mutant form of ligase IV is severely impaired for formation of the ligase IV-adenylate and assesses DNA binding by XRCC4
R327E
-
the mutant is nearly devoid of blunt end joining activity, mimicking a deletion of the zinc finger
R327E/D262R
-
the mutations do not restore efficient blunt end DNA joining activity
R716G
-
amino acid substitution within the conserved peptide of DNA ligase IIIbeta, does not complement Escherichia coli lig mutant
R722Q
-
amino acid substitution within the conserved peptide of DNA ligase IIIbeta, complements Escherichia coli lig mutant
R722V
-
amino acid substitution within the conserved peptide of DNA ligase IIIbeta, complements Escherichia coli lig mutant
R724G
-
amino acid substitution within the conserved peptide of DNA ligase IIIbeta, does not complement Escherichia coli lig mutant
R771W
-
Arg771-Trp mutation in DNA ligase I of cell line 46BR defective in DNA ligase I accounts for the malfunctioning but partly active enzyme present in 46BR cells that allows cell proliferation
R771W
-
mutant enzyme used in this study shows only 3% of normal activity
D253A
Q50566
mutant DNA ligase reacts with ATP to form the covalent intermediate, but is unable to catalyze the full ligation reaction
K251A
Q50566
no DNA ligase-adenylate formation and no nick-joining
D483A
-
mutant protein is inert in the ligase adenylylation reaction
E530A
-
mutant protein is inert in the ligase adenylylation reaction
E613A
-
mutant protein is inert in the ligase adenylylation reaction
H373A
-
mutant without 3'-5' single-stranded DNA exonuclease activity
K481A
-
mutant protein is inert in the ligase adenylylation reaction
K635A
-
mutant is active in autoadenylylation as wild-type LigD, consistent with its retention of overall nick-joining function
K637A
-
mutant enzyme forms about one-fourth the level of ligase-AMP compared to wild-type enzyme. Complete loss of function of overall nick ligation
CDELTA1
Paramecium bursaria chlorella virus
O41026
mutant with deleted C-terminal five amino acids: mutant shows 34% the specific activity of wild-type. Preformed Lig-AMP in vivo: 71% of total enzyme (wild-type: 70%), preformed Lig-AMP in vitro: 8% of total enzyme (wild-type: 21%)
CDELTA2
Paramecium bursaria chlorella virus
O41026
mutant with deleted C-terminal five amino acids: mutant shows 6% the specific activity of wild-type. Preformed Lig-AMP in vivo: 80% of total enzyme (wild-type: 70%), preformed Lig-AMP in vitro: 1.1% of total enzyme (wild-type: 21%)
CDELTA3
Paramecium bursaria chlorella virus
O41026
mutant with deleted C-terminal five amino acids: mutant shows 2% the specific activity of wild-type. Preformed Lig-AMP in vivo: 67% of total enzyme (wild-type: 70%), preformed Lig-AMP in vitro: 1.3% of total enzyme (wild-type: 21%)
CDELTA4
Paramecium bursaria chlorella virus
O41026
mutant with deleted C-terminal five amino acids: mutant shows 1% the specific activity of wild-type. Preformed Lig-AMP in vivo: 18% of total enzyme (wild-type: 70%), preformed Lig-AMP in vitro: 0.8% of total enzyme (wild-type: 21%)
CDELTA5
Paramecium bursaria chlorella virus
O41026
mutant with deleted C-terminal five amino acids: mutant shows 1% the specific activity of wild-type and is poorly responsive to ATP. Preformed Lig-AMP in vivo: 7% of total enzyme (wild-type: 70%), preformed Lig-AMP in vitro: 0.5% of total enzyme (wild-type: 21%)
D297A
Paramecium bursaria chlorella virus
O41026
preformed Lig-AMP in vivo: 76% of total enzyme (wild-type: 70%), preformed Lig-AMP in vitro: 2.9% of total enzyme (wild-type: 21%)
D297E
Paramecium bursaria chlorella virus
O41026
preformed Lig-AMP in vivo: 74% of total enzyme (wild-type: 70%), preformed Lig-AMP in vitro: 1.8% of total enzyme (wild-type: 21%)
D297N
Paramecium bursaria chlorella virus
O41026
preformed Lig-AMP in vivo: 60% of total enzyme (wild-type: 70%), preformed Lig-AMP in vitro: 2.8% of total enzyme (wild-type: 21%)
R293A
Paramecium bursaria chlorella virus
O41026
preformed Lig-AMP in vivo: 52% of total enzyme (wild-type: 70%), preformed Lig-AMP in vitro: 1.9% of total enzyme (wild-type: 21%)
R293K
Paramecium bursaria chlorella virus
O41026
preformed Lig-AMP in vivo: 70% of total enzyme (wild-type: 70%), preformed Lig-AMP in vitro: 3.4% of total enzyme (wild-type: 21%)
R293Q
Paramecium bursaria chlorella virus
O41026
preformed Lig-AMP in vivo: 48% of total enzyme (wild-type: 70%), preformed Lig-AMP in vitro: 3.8% of total enzyme (wild-type: 21%)
D15A
-
3'-ribonuclease activity with D10R2 primer-template is 110% of wild-type activity, 3'-phosphomonoesterase activity with D11-p primer-template is 3.3% of wild-type activity, 3'-phosphomonoesterase activity with D9R1-p primer template is 4.9% of wild-type activity
D83A
-
3'-ribonuclease activity with D10R2 primer-template is 57% of wild-type activity, 3'-phosphomonoesterase activity with D11-p primer-template is 51% of wild-type activity, 3'-phosphomonoesterase activity with D9R1-p primer template is 70% of wild-type activity
E21A
-
3'-ribonuclease activity with D10R2 primer-template is 130% of wild-type activity, 3'-phosphomonoesterase activity with D11-p primer-template is less than 0.1% of wild-type activity, 3'-phosphomonoesterase activity with D9R1-p primer template is less than 0.1% of wild-type activity
H42A
-
3'-ribonuclease activity with D10R2 primer-template is less than 0.1% of wild-type activity, 3'-phosphomonoesterase activity with D11-p primer-template is less than 0.1% of wild-type activity, 3'-phosphomonoesterase activity with D9R1-p primer template is 0.2% of wild-type activity
H48A
-
3'-ribonuclease activity with D10R2 primer-template is less than 0.1% of wild-type activity, 3'-phosphomonoesterase activity with D11-p primer-template is 0.8% of wild-type activity, 3'-phosphomonoesterase activity with D9R1-p primer template is 0.2% of wild-type activity
K66A
-
3'-ribonuclease activity with D10R2 primer-template is 2.9% of wild-type activity, 3'-phosphomonoesterase activity with D11-p primer-template is 28% of wild-type activity, 3'-phosphomonoesterase activity with D9R1-p primer template is 48% of wild-type activity
Q40A
-
3'-ribonuclease activity with D10R2 primer-template is 41% of wild-type activity, 3'-phosphomonoesterase activity with D11-p primer-template is 6.7% of wild-type activity, 3'-phosphomonoesterase activity with D9R1-p primer template is 8.6% of wild-type activity
R14A
-
3'-ribonuclease activity with D10R2 primer-template is 77% of wild-type activity, 3'-phosphomonoesterase activity with D11-p primer-template is 0.2% of wild-type activity, 3'-phosphomonoesterase activity with D9R1-p primer template is 0.1% of wild-type activity
R46A
-
3'-ribonuclease activity with D10R2 primer-template is 16% of wild-type activity, 3'-phosphomonoesterase activity with D11-p primer-template is 19% of wild-type activity, 3'-phosphomonoesterase activity with D9R1-p primer template is 67% of wild-type activity
R76A
-
3'-ribonuclease activity with D10R2 primer-template is 1.1% of wild-type activity, 3'-phosphomonoesterase activity with D11-p primer-template is 16% of wild-type activity, 3'-phosphomonoesterase activity with D9R1-p primer template is 44% of wild-type activity
Y88A
-
3'-ribonuclease activity with D10R2 primer-template is 7.1% of wild-type activity, 3'-phosphomonoesterase activity with D11-p primer-template is 0.2% of wild-type activity, 3'-phosphomonoesterase activity with D9R1-p primer template is less than 0.1% of wild-type activity
D540A
-
mutant exhibits notably enhanced nick-joining activity compared with that of the wild type enzyme, the mutant enzyme exhibits activity about twice as high as that of the wild type within 10 min
D540A/Q547A/K554A/K558A
-
the mutant enzyme exhibits activity about twice as high as that of the wild type within 10 min. The D540A ligation is almost the same as that of the D540A/Q547A/K554A/K558A mutant enzyme, thus implying that a single substitution for Asp540 might exert a more dominant effect than the substitutions of the other three polar and ionic residues at the C terminus
D540K
-
the mutant exhibits notably enhanced nick-joining activity compared with that of the wild type enzyme
D540R
-
the mutant exhibits notably enhanced nick-joining activity compared with that of the wild type enzyme
D540R/delC4
-
DelC4 i.e. deletion of the four C-terminal residues, nick-joining activities of the mutant is enhanced as compared to that of the D540R single substitution
D540R/DELTAC4
-
the combination of the Asp540-replacement and the elimination of ionic residues in the helix, forming interactions with adenylylation domain, effectively enhances the activity
D540R/K554A/K558A
-
the combination of the Asp540-replacement and the elimination of ionic residues in the helix, forming interactions with adenylylation domain, effectively enhances the activity, nick-joining activities of the mutant is enhanced, as compared to that of the D540R single substitution
D540S
-
the mutant exhibits notably enhanced nick-joining activity compared with that of the wild type enzyme
K249A
-
mutant enzyme shows no no adenylyltransferase activity
K534A
-
the wild-type R531A and mutant K534A enzymes exhibit almost the same DNA ligation activities both in the presence and in the absence of externally added ATP, contains AMP in the crystal
Q547A/K554A/K558A
-
nick ligation activity of the mutant is slightly higher than that of the wild type enzyme
R531A
-
the wild-type R531A and mutant K534A enzymes exhibit almost the same DNA ligation activities both in the presence and in the absence of externally added ATP, contains AMP in the crystal
R531A/K534A
-
the mutations of both basic residues (R531A and K534A) severely affected the ligation activity, especially in the absence of ATP, does not contain AMP in the crystal
R544A
-
mutant R544A displays a notable reduction in nick-joining activity (less than 45% of the input substrate ligated) in comparison with that of mutant R544A/Q547A/K554A/K558A
R544A/Q547A/K554A/K558A
-
mutant enzyme exhibits low activity. Mutant R544A displays a notable reduction in nick-joining activity (less than 45% of the input substrate ligated) in comparison with that of mutant R544A/Q547A/K554A/K558A
K727R
-
amino acid substitution within the conserved peptide of DNA ligase IIIbeta, does not complement Escherichia coli lig mutant
additional information
-
deletion of the zinc finger does not significantly change LigIII DNA binding affinity, nor does it abrogate the specificity of the enzyme for a nicked substrate
additional information
-
loss of DNA ligase IV prevents recognition of DNA by double-strand break repair proteins XRCC4 and XLF
additional information
-
the 1762delAAG and 588delK variants are associated with LIG4 syndrome, the 588delKvariant does not alter the reading frame of the DNA ligase IV protein but destabilizes the ligase IV protein
S714I
-
amino acid substitution within the conserved peptide of DNA ligase IIIbeta, does not complement Escherichia coli lig mutant
additional information
B6ZH51
mutants (mglig4) show no defects in asexual or sexual growth, and are fully pathogenic, compared to the wild type enzyme, mglig4 exhibits weak sensitivity to a DNA-damaging agent camptothecin, non-homologous integration of DNA is frequently observed in mglig4 transformants
molecular biology
-
the enzyme is used in the ligase chain reaction
additional information
-
combination of the D540R-replacement and the elimination of ionic residues in the helix, forming interactions with AdD, effectively enhances the activity
APPLICATION
ORGANISM
UNIPROT
COMMENTARY
LITERATURE
analysis
-
essential reagent in studies on nucleic acid structure and metabolism. In combination with polynucleotide kinase end-group labeling, DNA ligase can be used to identify 3'- and 5'-end groups at single-strand interruptions by nearest neighbor analysis. DNA
analysis
-
DNA automaton based on FokI without ligase has similar efficiency as with ligase in the context of automaton reactions. Other enzymes (HgaI, BsmFI, BbsI, and BseMII) show more discrepancy between with and without ligase
synthesis
-
plays an important role for recombination of DNA fragments in vitro
analysis
-
essential reagent in studies on nucleic acid structure and metabolism. In combination with polynucleotide kinase end-group labeling, DNA ligase can be used to identify 3'- and 5'-end groups at single-strand interruptions by nearest neighbor analysis. DNA
analysis
-
piezoelectric method for DNA point mutation detection based on DNA ligase reaction and nano-Au-amplified DNA probe
analysis
-
a procedure for fast, sensitive and quantitative measurement of DNA ligase activity in crude cell extract
analysis
-
essential reagent in studies on nucleic acid structure and metabolism. In combination with polynucleotide kinase end-group labeling, DNA ligase can be used to identify 3'- and 5'-end groups at single-strand interruptions by nearest neighbor analysis. DNA
molecular biology
-
LihTh1519 may be used for basic and applied researches in molecular biology and genetic engineering
molecular biology
-
LihTh1519 may be used for basic and applied researches in molecular biology and genetic engineering
-