Cloned (Comment) | Organism |
---|---|
- |
uncultured archaeon |
Metals/Ions | Comment | Organism | Structure |
---|---|---|---|
Mn2+ | the enzyme is most active when Mn2+ is present as divalent metal cofactor rather than Mg2+ and Ca2+ etc. | uncultured archaeon |
Organism | UniProt | Comment | Textmining |
---|---|---|---|
uncultured archaeon | - |
acidophilic archaebacterium JP2 from geothermally active sites in Papua New Guinea | - |
Purification (Comment) | Organism |
---|---|
- |
uncultured archaeon |
Substrates | Comment Substrates | Organism | Products | Comment (Products) | Rev. | Reac. |
---|---|---|---|---|---|---|
ATP + (deoxyribonucleotide)n + (deoxyribonucleotide)m | the donor strans is 42 bp (5'TCCGCGGATCCTGAGGTGAAATGTAAATGAAAAAGCCTGAAC3'), acceptor strand is 38 bp (5'CGTCGAGCAGCGAACCTACTGCGTGGCTTCCGGAGCTA3'), and the complement array stran is 80 bp (5'GTTCAGGCTTTTTCATTTACATTTCACCTCAGGATCCGCGGATAGCTCCGGAAGCCACGCAGTAGGTTCGCTGCTCGACG3') | uncultured archaeon | AMP + diphosphate + (deoxyribonucleotide)n+m | - |
? |
Synonyms | Comment | Organism |
---|---|---|
ATP-dependent DNA ligase | - |
uncultured archaeon |
Temperature Optimum [°C] | Temperature Optimum Maximum [°C] | Comment | Organism |
---|---|---|---|
50 | 80 | the enzyme displayed relative high activity | uncultured archaeon |
65 | - |
assay at | uncultured archaeon |
Temperature Stability Minimum [°C] | Temperature Stability Maximum [°C] | Comment | Organism |
---|---|---|---|
80 | - |
5 h, about 5% loss of activity, lysate of cell harbouring with recombinant JP2 ligase gene | uncultured archaeon |
85 | - |
5 h, about 10% loss of activity, lysate of cell harbouring with recombinant JP2 ligase gene | uncultured archaeon |
90 | - |
1 h, about 55% loss of activity, lysate of cell harbouring with recombinant JP2 ligase gene | uncultured archaeon |
95 | - |
10 min, about 80% loss of activity, lysate of cell harbouring with recombinant JP2 ligase gene | uncultured archaeon |
pH Optimum Minimum | pH Optimum Maximum | Comment | Organism |
---|---|---|---|
7.4 | - |
assay at | uncultured archaeon |