EC Number   |
Inhibitors |
Structure  |
|---|
   3.4.21.5 | more |
inhibitor binding mechanism and kinetics |
 |
| 3.4.21.5 | more |
heparin and dermatan sulfate use different binding sites of HCII than the Chlorophyta sulfated polysaccharides, which are more effective inhibitors even with recombinant mutant HCII, that is no longer active with heparin and dermatan sulfate, overview |
|
| 3.4.21.5 | more |
no inhibition by cycloheximide |
|
| 3.4.21.5 | more |
computational modeling, inhibitor binding mechanism, preference of binding of different benzamidine derivatives due to thermodynamic measurements and and hydration in descending order: 4-(2-oxo-1-propyl)benzamidine, 4-ethylbenzamidine, 4-(1-propyl)benzamidine, 4-methylbenzamidine, benzamidine, 4-amidinophenylpyruvate, inhibitors bind to Ser195 |
|
| 3.4.21.5 | more |
inhibition mechanism |
|
| 3.4.21.5 | more |
schematic representation of inhibition mode |
|
| 3.4.21.5 | more |
not inhibitory: acetyl-L-Ala-L-Phe methyl ester |
|
| 3.4.21.5 | more |
thrombin-mediated expression of interleukin-6 and CXCL8 is significantly inhibited by LY294002, AKT IV, RO318220, and GF109203X as well as by diphenyleneiodium at the messenger RNA and the protein levels. SB202129 and U0126 also significantly attenuate thrombin-mediated release of interleukin-6 and CXCL8 proteins from human aortic smooth muscle cell |
|
| 3.4.21.5 | more |
not inhibited by soybean trypsin inhibitor |
|
| 3.4.21.5 | more |
the DNA aptamers 15TBA (GGTTGGTGTGGTTGG) and 31TBA (CACTGGTAGGTTGGTGTGGTTGGGGCCAGTG) added to human plasma dose-dependently increase fibrin formation upon exposure to exogenous thrombin, clotting activation by the extrinsic pathway, and activated partial clotting activation by the intrinsic pathway. At the same time, these aptamers do not modify amidolytic activity of thrombin |
|
