Any feedback?
Literature summary for 3.1.3.32 extracted from
- Amplified detection of DNA ligase and polynucleotide kinase/phosphatase on the basis of enrichment of catalytic G-quadruplex DNAzyme by rolling circle amplification (2014), Biosens. Bioelectron., 55, 133-138.
Natural Substrates/ Products (Substrates)
| Natural Substrates | Organism | Comment (Nat. Sub.) | Natural Products | Comment (Nat. Pro.) | Rev. | Reac. |
|---|---|---|---|---|---|---|
| 3'-phospho-5'-hydroxy-DNA + H2O | Tequatrovirus T4 | - |
? | - |
? |  |
Organism
| Organism | UniProt | Comment | Textmining |
|---|---|---|---|
| Tequatrovirus T4 | - |
- |
- |
Substrates and Products (Substrate)
| Substrates | Comment Substrates | Organism | Products | Comment (Products) | Rev. | Reac. |
|---|---|---|---|---|---|---|
| 3'-phospho-5'-hydroxy-ATTCGTGTGAGAAAACCCAACCCGCCCTACCCAAAAGTCAGATGA + H2O | the enzyme mediates 5'-phosphorylation of ATTCGTGTGAGAAAACCCAACCCGCCCTACCCAAAAGTCAGATGA | Tequatrovirus T4 | ? | - |
? | |
| 3'-phospho-5'-hydroxy-DNA + H2O | - |
Tequatrovirus T4 | ? | - |
? | |
| additional information | polynucleotide kinase/phosphatase is a bifunctional enzyme with 5'-kinase and 3'-phosphatase activities which can generate 5'-phosphate and 3'-hydroxyl groups at damaged DNA termini, thus permitting subsequent repair proteins to replace missing nucleotides and rejoin broken strands | Tequatrovirus T4 | ? | - |
? | |
Synonyms
| Synonyms | Comment | Organism |
|---|---|---|
| PNKP | - |
Tequatrovirus T4 |
| polynucleotide kinase/phosphatase | - |
Tequatrovirus T4 |
General Information
| General Information | Comment | Organism |
|---|---|---|
| physiological function | this enzyme plays an important role in nucleic acid metabolism and DNA repairing during strand interruption | Tequatrovirus T4 |
Use of this online version of BRENDA is free under the CC BY 4.0 license. See terms of use for full details.
Release 2023.1 (January 2023)
Legal
Curated at
Member of
