Please wait a moment until all data is loaded. This message will disappear when all data is loaded.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
5'-[GpppA]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O
?
-
the substrate is 95% decapped at 0.0027 mM enzyme
-
-
?
5'-[GpppC]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O
?
-
the substrate is 95% decapped at 0.0027 mM enzyme
-
-
?
5'-[GpppG]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O
?
-
the substrate is 95% decapped at 0.0027 mM enzyme
-
-
?
5'-[GpppU]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O
?
-
the substrate is 95% decapped at 0.0027 mM enzyme
-
-
?
5'-[m7AraGpppA]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O
?
-
the substrate is 95% decapped at 0.0027 mM enzyme
-
-
?
5'-[m7AraGpppC]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O
?
-
the substrate is 95% decapped at 0.0027 mM enzyme
-
-
?
5'-[m7AraGpppG]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O
?
-
the substrate is 95% decapped at 0.0027 mM enzyme
-
-
?
5'-[m7AraGpppU]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O
?
-
the substrate is 95% decapped at 0.0027 mM enzyme
-
-
?
5'-[m7dGpppA]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O
?
-
the substrate is 95% decapped at 0.0027 mM enzyme
-
-
?
5'-[m7dGpppC]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O
?
-
the substrate is 95% decapped at 0.0027 mM enzyme
-
-
?
5'-[m7dGpppG]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O
?
-
the substrate is 95% decapped at 0.0027 mM enzyme
-
-
?
5'-[m7dGpppU]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O
?
-
the substrate is 95% decapped at 0.0027 mM enzyme
-
-
?
5'-[m7GppPAm]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O
?
-
the substrate is 95% decapped at 0.0027 mM enzyme
-
-
?
5'-[m7GpppA]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O
?
-
the substrate is 95% decapped at 0.0027 mM enzyme
-
-
?
5'-[m7GpppCm]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O
?
-
the substrate is 95% decapped at 0.0027 mM enzyme
-
-
?
5'-[m7GpppC]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O
?
-
the substrate is 95% decapped at 0.0027 mM enzyme
-
-
?
5'-[m7GpppGm]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O
?
-
the substrate is 95% decapped at 0.0027 mM enzyme
-
-
?
5'-[m7GpppG]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O
?
-
the substrate is 95% decapped at 0.0027 mM enzyme
-
-
?
5'-[m7Gpppm6Am]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O
?
-
the substrate is 95% decapped at 0.0027 mM enzyme
-
-
?
5'-[m7Gpppm6A]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O
?
-
the substrate is 95% decapped at 0.0027 mM enzyme
-
-
?
5'-[m7GpppUm]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O
?
-
the substrate is 95% decapped at 0.0027 mM enzyme
-
-
?
5'-[m7GpppU]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O
?
-
the substrate is 95% decapped at 0.0027 mM enzyme
-
-
?
5'-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3' + H2O
?
-
the substrate is 95% decapped at 0.0027 mM enzyme
-
-
?
7-dimethylguanosine 5'-[3-(5'-guanosinyl)-3-boranotriphosphate] + H2O
7-methylguanosine 5'-phosphate + ?
7-methylguanosin-5'-yl-[3-(5'-guanosinyl)-2-boranotriphosphate] + H2O
7-methylguanosine 5'-phosphate + ?
7-methylguanosine 5'-diphosphate + H2O
7-methylguanosine 5'-phosphate + phosphate
7-methylguanosine 5'-diphosphate + nucleotidyl 5'-diphosphate + H2O
7-methylguanosine 5'-phosphate + ?
-
-
-
?
a 5'-(N7-methyl 5'-triphosphoguanosine)-[mRNA] + H2O
N7-methylguanosine 5'-phosphate + a 5'-diphospho-[mRNA]
-
the enzyme decaps RNA transcripts as long as 1400 nucleotides
-
-
?
m7G5'ppp5'G + H2O
7-methylguanosine 5'-phosphate + ?
-
-
-
?
m7G5'ppp5'G + H2O
7-methylguanosine 5'-phosphate + GDP
m7G5'ppp5'N(3'ppp5'N)n + H2O
7-methylguanosine 5'-phosphate + pp5'N(3'ppp5'N)n
additional information
?
-
7-dimethylguanosine 5'-[3-(5'-guanosinyl)-3-boranotriphosphate] + H2O
7-methylguanosine 5'-phosphate + ?
boranophosphate analog of the mRNA cap. 90 Min reaction time, 6% cleavage of S-enantiomer, 97% cleavage of R-enantiomer
-
-
?
7-dimethylguanosine 5'-[3-(5'-guanosinyl)-3-boranotriphosphate] + H2O
7-methylguanosine 5'-phosphate + ?
boranophosphate analog of the mRNA cap. 90 Min reaction time, 11% cleavage of S-enantiomer, 98% cleavage of R-enantiomer
-
-
?
7-methylguanosin-5'-yl-[3-(5'-guanosinyl)-2-boranotriphosphate] + H2O
7-methylguanosine 5'-phosphate + ?
boranophosphate analog of the mRNA cap. 10 Min reaction time, 90-100% cleavage
-
-
?
7-methylguanosin-5'-yl-[3-(5'-guanosinyl)-2-boranotriphosphate] + H2O
7-methylguanosine 5'-phosphate + ?
boranophosphate analog of the mRNA cap. 90 Min reaction time, 12-19% cleavage
-
-
?
7-methylguanosine 5'-diphosphate + H2O
7-methylguanosine 5'-phosphate + phosphate
-
-
-
?
7-methylguanosine 5'-diphosphate + H2O
7-methylguanosine 5'-phosphate + phosphate
eukaryotic mRNA degradation proceeds through two main pathways, both involving mRNA cap breakdown. In the 3'-5' mRNA decay pathway, mRNA body degradation generates free m7GpppN that is hydrolyzed by DcpS generating m7GMP. In the 5'-3' pathway, the recently identified human Dcp2 decapping enzyme cleaves the cap of deadenylated mRNAs to produce m7GDP and 5'-phosphorylated mRNA
-
-
?
7-methylguanosine 5'-diphosphate + H2O
7-methylguanosine 5'-phosphate + phosphate
-
-
-
?
7-methylguanosine 5'-diphosphate + H2O
7-methylguanosine 5'-phosphate + phosphate
cleavage of 7-methylguanosine 5'-diphosphate generated by Dcp1/Dcp2-mediated decapping in the 5' to 3' decay pathway
-
-
?
7-methylguanosine 5'-diphosphate + H2O
7-methylguanosine 5'-phosphate + phosphate
mRNA degradation occurs through distinct pathways, one primarily from the 5' end of the mRNA and the second from the 3' end. Decay from the 3' end generates the m7G5'ppp5'N cap dinucleotide, which is subsequently hydrolyzed to m7Gp and nucleotidyl 5'-diphosphate in Saccharomyces cerevisiae by a scavenger decapping activity termed Dcs1p
-
-
?
m7G5'ppp5'G + H2O
7-methylguanosine 5'-phosphate + GDP
-
-
-
?
m7G5'ppp5'G + H2O
7-methylguanosine 5'-phosphate + GDP
-
-
-
?
m7G5'ppp5'N(3'ppp5'N)n + H2O
7-methylguanosine 5'-phosphate + pp5'N(3'ppp5'N)n
eukaryotic cells utilize DcpS, a scavenger decapping enzyme, to degrade the residual cap structure following 30-50 mRNA decay, thereby preventing the premature decapping of the capped long mRNA and misincorporation of methylated nucleotides in nucleic acids
-
-
?
m7G5'ppp5'N(3'ppp5'N)n + H2O
7-methylguanosine 5'-phosphate + pp5'N(3'ppp5'N)n
n = 1-8
-
-
?
m7G5'ppp5'N(3'ppp5'N)n + H2O
7-methylguanosine 5'-phosphate + pp5'N(3'ppp5'N)n
n = 1-8, decapping is an important process in the control of eukaryotic mRNA degradation. The scavenger decapping enzyme DcpS functions to clear the cell of cap structure following decay of the RNA body by catalyzing the hydrolysis of m7GpppN to m7Gp and ppN
-
-
?
m7G5'ppp5'N(3'ppp5'N)n + H2O
7-methylguanosine 5'-phosphate + pp5'N(3'ppp5'N)n
n = 1-8, eukaryotic mRNA degradation proceeds through two main pathways, both involving mRNA cap breakdown. In the 3'-5' mRNA decay pathway, mRNA body degradation generates free m7GpppN that is hydrolyzed by DcpS generating m7GMP. In the 5'-3' pathway, the recently identified human Dcp2 decapping enzyme cleaves the cap of deadenylated mRNAs to produce m7GDP and 5'-phosphorylated mRNA
-
-
?
m7G5'ppp5'N(3'ppp5'N)n + H2O
7-methylguanosine 5'-phosphate + pp5'N(3'ppp5'N)n
n = 1-8, DcpS is capable of acting on an mRNA once it is degraded down to 10 nuceotides
-
-
?
m7G5'ppp5'N(3'ppp5'N)n + H2O
7-methylguanosine 5'-phosphate + pp5'N(3'ppp5'N)n
n = 1-8, the recombinant protein specifically hydrolyzes methylated cap analog but does not hydrolyze unmethylated cap analog nor does it function on intact capped RNA. DcpS is capable of acting on an mRNA once it is degraded down to 10 nucleotides
-
-
?
m7G5'ppp5'N(3'ppp5'N)n + H2O
7-methylguanosine 5'-phosphate + pp5'N(3'ppp5'N)n
Tyr273 seems to play an important role in cap binding and product release
-
-
?
m7G5'ppp5'N(3'ppp5'N)n + H2O
7-methylguanosine 5'-phosphate + pp5'N(3'ppp5'N)n
cleavage of 5' end m7G-oligoribonucleotide fragments generated by 3' to 5' exonucleolytic decay
-
-
?
m7G5'ppp5'N(3'ppp5'N)n + H2O
7-methylguanosine 5'-phosphate + pp5'N(3'ppp5'N)n
n = 1-8
-
-
?
m7G5'ppp5'N(3'ppp5'N)n + H2O
7-methylguanosine 5'-phosphate + pp5'N(3'ppp5'N)n
n = 1-8, mRNA degradation occurs through distinct pathways, one primarily from the 5' end of the mRNA and the second from the 3' end. Decay from the 3' end generates the m7GpppN cap dinucleotide, which is subsequently hydrolyzed to m7Gp and ppN in Saccharomyces cerevisiae by a scavenger decapping activity termed Dcs1p
-
-
?
additional information
?
-
Dcps shows no activity with 7-methylguanosine 5'-diphosphate
-
-
?
additional information
?
-
-
the enzyme can decap most guanosine caps. In contrast, it shows no activity towards adenosine, cytidine or uridine capped RNAs
-
-
-
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
7-methylguanosine 5'-diphosphate + H2O
7-methylguanosine 5'-phosphate + phosphate
a 5'-(N7-methyl 5'-triphosphoguanosine)-[mRNA] + H2O
N7-methylguanosine 5'-phosphate + a 5'-diphospho-[mRNA]
-
the enzyme decaps RNA transcripts as long as 1400 nucleotides
-
-
?
m7G5'ppp5'N(3'ppp5'N)n + H2O
7-methylguanosine 5'-phosphate + pp5'N(3'ppp5'N)n
7-methylguanosine 5'-diphosphate + H2O
7-methylguanosine 5'-phosphate + phosphate
-
-
-
?
7-methylguanosine 5'-diphosphate + H2O
7-methylguanosine 5'-phosphate + phosphate
eukaryotic mRNA degradation proceeds through two main pathways, both involving mRNA cap breakdown. In the 3'-5' mRNA decay pathway, mRNA body degradation generates free m7GpppN that is hydrolyzed by DcpS generating m7GMP. In the 5'-3' pathway, the recently identified human Dcp2 decapping enzyme cleaves the cap of deadenylated mRNAs to produce m7GDP and 5'-phosphorylated mRNA
-
-
?
7-methylguanosine 5'-diphosphate + H2O
7-methylguanosine 5'-phosphate + phosphate
cleavage of 7-methylguanosine 5'-diphosphate generated by Dcp1/Dcp2-mediated decapping in the 5' to 3' decay pathway
-
-
?
7-methylguanosine 5'-diphosphate + H2O
7-methylguanosine 5'-phosphate + phosphate
mRNA degradation occurs through distinct pathways, one primarily from the 5' end of the mRNA and the second from the 3' end. Decay from the 3' end generates the m7G5'ppp5'N cap dinucleotide, which is subsequently hydrolyzed to m7Gp and nucleotidyl 5'-diphosphate in Saccharomyces cerevisiae by a scavenger decapping activity termed Dcs1p
-
-
?
m7G5'ppp5'N(3'ppp5'N)n + H2O
7-methylguanosine 5'-phosphate + pp5'N(3'ppp5'N)n
eukaryotic cells utilize DcpS, a scavenger decapping enzyme, to degrade the residual cap structure following 30-50 mRNA decay, thereby preventing the premature decapping of the capped long mRNA and misincorporation of methylated nucleotides in nucleic acids
-
-
?
m7G5'ppp5'N(3'ppp5'N)n + H2O
7-methylguanosine 5'-phosphate + pp5'N(3'ppp5'N)n
n = 1-8
-
-
?
m7G5'ppp5'N(3'ppp5'N)n + H2O
7-methylguanosine 5'-phosphate + pp5'N(3'ppp5'N)n
n = 1-8, decapping is an important process in the control of eukaryotic mRNA degradation. The scavenger decapping enzyme DcpS functions to clear the cell of cap structure following decay of the RNA body by catalyzing the hydrolysis of m7GpppN to m7Gp and ppN
-
-
?
m7G5'ppp5'N(3'ppp5'N)n + H2O
7-methylguanosine 5'-phosphate + pp5'N(3'ppp5'N)n
n = 1-8, eukaryotic mRNA degradation proceeds through two main pathways, both involving mRNA cap breakdown. In the 3'-5' mRNA decay pathway, mRNA body degradation generates free m7GpppN that is hydrolyzed by DcpS generating m7GMP. In the 5'-3' pathway, the recently identified human Dcp2 decapping enzyme cleaves the cap of deadenylated mRNAs to produce m7GDP and 5'-phosphorylated mRNA
-
-
?
m7G5'ppp5'N(3'ppp5'N)n + H2O
7-methylguanosine 5'-phosphate + pp5'N(3'ppp5'N)n
cleavage of 5' end m7G-oligoribonucleotide fragments generated by 3' to 5' exonucleolytic decay
-
-
?
m7G5'ppp5'N(3'ppp5'N)n + H2O
7-methylguanosine 5'-phosphate + pp5'N(3'ppp5'N)n
n = 1-8
-
-
?
m7G5'ppp5'N(3'ppp5'N)n + H2O
7-methylguanosine 5'-phosphate + pp5'N(3'ppp5'N)n
n = 1-8, mRNA degradation occurs through distinct pathways, one primarily from the 5' end of the mRNA and the second from the 3' end. Decay from the 3' end generates the m7GpppN cap dinucleotide, which is subsequently hydrolyzed to m7Gp and ppN in Saccharomyces cerevisiae by a scavenger decapping activity termed Dcs1p
-
-
?
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Malys, N.; McCarthy, J.E.
Dcs2, a novel stress-induced modulator of m7GpppX pyrophosphatase activity that locates to P bodies
J. Mol. Biol.
363
370-382
2006
Saccharomyces cerevisiae (Q06151), Saccharomyces cerevisiae
brenda
Singh, J.; Salcius, M.; Liu, S.W.; Staker, B.L.; Mishra, R.; Thurmond, J.; Michaud, G.; Mattoon, D.R.; Printen, J.; Christensen, J.; Bjornsson, J.M.; Pollok, B.A.; Kiledjian, M.; Stewart, L.; Jarecki, J.; Gurney, M.E.
DcpS as a therapeutic target for spinal muscular atrophy
ACS Chem. Biol.
3
711-722
2008
Homo sapiens (Q96C86)
brenda
Liu, H.; Rodgers, N.D.; Jiao, X.; Kiledjian, M.
The scavenger mRNA decapping enzyme DcpS is a member of the HIT family of pyrophosphatases
EMBO J.
21
4699-4708
2002
Saccharomyces cerevisiae (Q06151), Homo sapiens (Q96C86)
brenda
Liu, S.W.; Rajagopal, V.; Patel, S.S.; Kiledjian, M.
Mechanistic and kinetic analysis of the DcpS scavenger decapping enzyme
J. Biol. Chem.
283
16427-16436
2008
Homo sapiens (Q96C86)
brenda
Chen, N.; Walsh, M.A.; Liu, Y.; Parker, R.; Song, H.
Crystal structures of human DcpS in ligand-free and m7GDP-bound forms suggest a dynamic mechanism for scavenger mRNA decapping
J. Mol. Biol.
347
707-718
2005
Homo sapiens (Q96C86)
brenda
Liu, H.; Kiledjian, M.
Scavenger decapping activity facilitates 5' to 3' mRNA decay
Mol. Cell. Biol.
25
9764-9772
2005
Saccharomyces cerevisiae (Q06151)
brenda
Szczepaniak, S.A.; Jemielity, J.; Zuberek, J.; Kufel, J.; Darzynkiewicz, E.
Bisphosphonate mRNA cap analog attached to Sepharose for affinity chromatography of decapping enzymes
Nucleic Acids Symp. Ser.
52
295-296
2008
Arabidopsis thaliana
brenda
van Dijk, E.; Le Hir, H.; Sraphin, B.
DcpS can act in the 5'-3' mRNA decay pathway in addition to the 3'-5' pathway
Proc. Natl. Acad. Sci. USA
100
12081-12086
2003
Homo sapiens (Q96C86)
brenda
Han, G.W.; Schwarzenbacher, R.; McMullan, D.; Abdubek, P.; Ambing, E.; Axelrod, H.; Biorac, T.; Canaves, J.M.; Chiu, H.J.; Dai, X.; Deacon, A.M.; DiDonato, M.; Elsliger, M.A.; Godzik, A.; Grittini, C.; Grzechnik, S.K.; Hale, J.; Hampton, E.; Haugen, J.; Hornsby, M.; Jaroszewski, L.; Klock, H.E.; Koesema, E.; Kreusch, A.; Kuhn, P.; Lesley, S.A.; McPhillips, T.M.; Miller, M.D.; Moy, K.; Nigoghossian, E.; Paulsen, J.; Quijano, K.; Reyes, R.; Spraggon, G.; Stevens R.C.; van den Bedem, H.; Velasquez, J.; Vincent, J.; White, A.; Wolf, G.; Xu, Q.; Hodgson, K.O.; Wooley, J.; Wilson, I.A.
Crystal structure of an Apo mRNA decapping enzyme (DcpS) from Mouse at 1.83 A resolution
Proteins
60
797-802
2005
Mus musculus (Q9DAR7)
brenda
Liu, S.W.; Jiao, X.; Liu, H.; Gu, M.; Lima, C.D.; Kiledjian, M.
Functional analysis of mRNA scavenger decapping enzymes
RNA
10
1412-1422
2004
Homo sapiens (Q96C86)
brenda
Shen, V.; Liu, H.; Liu, S.W.; Jiao, X.; Kiledjian, M.
DcpS scavenger decapping enzyme can modulate pre-mRNA splicing
RNA
14
1132-1142
2008
Homo sapiens (Q96C86)
brenda
Kowalska, J.; Wypijewska del Nogal, A.; Darzynkiewicz, Z.M.; Buck, J.; Nicola, C.; Kuhn, A.N.; Lukaszewicz, M.; Zuberek, J.; Strenkowska, M.; Ziemniak, M.; Maciejczyk, M.; Bojarska, E.; Rhoads, R.E.; Darzynkiewicz, E.; Sahin, U.; Jemielity, J.
Synthesis, properties, and biological activity of boranophosphate analogs of the mRNA cap: versatile tools for manipulation of therapeutically relevant cap-dependent processes
Nucleic Acids Res.
42
10245-10264
2014
Caenorhabditis elegans (G5EFS4), Homo sapiens (Q96C86)
brenda
Wulf, M.G.; Buswell, J.; Chan, S.H.; Dai, N.; Marks, K.; Martin, E.R.; Tzertzinis, G.; Whipple, J.M.; Correa, I.R.; Schildkraut, I.
The yeast scavenger decapping enzyme DcpS and its application for in vitro RNA recapping
Sci. Rep.
9
8594
2019
Saccharomyces cerevisiae
brenda