Please wait a moment until all data is loaded. This message will disappear when all data is loaded.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
aalpha6beta1 + H2O
?
Substrates: -
Products: -
?
benzoyl-beta-Ala-Gly-Arg-4-nitroanilide + H2O
benzoyl-beta-Ala-Gly-Arg + 4-nitroaniline
-
Substrates: -
Products: -
?
casein + H2O
?
Substrates: -
Products: -
?
Cellular receptor of urokinase-type plasminogen activator + H2O
?
-
Substrates: cleavage between domains 1 and 2 generating a cell-associated variant of the receptor of urokinase-type plasminogen activator without ligand-binding properties, uPA catalyzed cleavage does not require binding of the protease to the receptor through its epidermal growth factor-like receptor-binding domain, low-molecular weight uPA lacking this domain also cleaves the substrate
Products: -
?
D-Glu-Gly-Arg-4-nitroanilide + H2O
D-Glu-Gly-Arg + 4-nitroaniline
-
Substrates: a uPA substrate S-2444
Products: -
?
D-Ile-Pro-Arg-4-nitroanilide + H2O
D-Ile-Pro-Arg + 4-nitroaniline
Substrates: -
Products: -
?
D-Val-Leu-Lys-4-nitroanilide + H2O
D-Val-Leu-Lys + 4-nitroaniline
-
Substrates: -
Products: -
?
epithelial sodium channel gamma subunit + H2O
?
-
Substrates: of Xenopus laevis ocytes, activation by proteolytic cleavage at 177GR-/-KR180
Products: -
?
Fibronectin + H2O
?
Substrates: -
Products: -
?
Gly-Gly-Arg-D-aminoluciferin + H2O
D-aminoluciferin + Gly-Gly-Arg
Substrates: -
Products: -
?
Gly-Gly-Arg-D-aminoluciferin + H2O
Gly-Gly-Arg + D-aminoluciferin
Substrates: GGR-AmLuc is composed of two moieties: a tripeptide substrate Gly-Gly-Arg (GGR) and a D-aminoluciferin (AmLuc) motif for emitting bioluminescence (BL). Upon specific uPA cleavage of the GGR substrate from GGR-AmLuc, the enzymatic product AmLuc can emit an obvious BL signal under firefly luciferase (fLuc) catalysis, together with the combined action of Mg2+, O2, and ATP, overview
Products: -
?
GSGRSA + H2O
GSGR + Ser-Ala
-
Substrates: -
Products: -
?
HYGRSA + H2O
HYGR + Ser-Ala
-
Substrates: -
Products: -
?
integrin + H2O
?
Substrates: -
Products: -
?
kininogen + H2O
kinin + ?
-
Substrates: -
Products: -
?
L-diglutamyl-glycyl-L-arginine 4-nitroanilide + H2O
L-diglutamyl-glycyl-L-arginine + 4-nitroaniline
Substrates: -
Products: -
?
L-diglutamyl-glycyl-L-arginine-4-nitroanilide + H2O
L-diglutamyl-glycyl-L-arginine + 4-nitroaniline
-
Substrates: -
Products: -
?
L-pyroGlu-Gly-L-Arg-4-nitroanilide + H2O
L-pyroGlu-Gly-L-Arg + 4-nitroaniline
L-pyroglutamyl-glycyl-L-arginine-p-nitroanilide + H2O
L-pyroglutamyl-glycyl-L-arginine + 4-nitroaniline
-
Substrates: -
Products: -
?
N-benzyloxycarbonyl-Gly-Gly-Arg-7-amido-4-trifluoromethylcoumarin + H2O
N-benzyloxycarbonyl-Gly-Gly-Arg + 7-amino-4-trifluoromethylcoumarin
-
Substrates: -
Products: -
?
PFGRSA + H2O
PFGR + Ser-Ala
-
Substrates: -
Products: -
?
plasmin + H2O
?
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
pro-hepatic growth factor + H2O
mature hepatic growth factor + ?
pyro-Glu-Pro-Arg-4-nitroanilide + H2O
pyro-Glu-Pro-Arg + 4-nitroaniline
Substrates: -
Products: -
?
pyroGlu-Gly-Arg-4-nitroanilide + H2O
pyroGlu-Gly-Arg + 4-nitroaniline
-
Substrates: i.e. S-2444, a chromogenic substrate
Products: -
?
QRGRSA + H2O
QRGR + Ser-Ala
-
Substrates: -
Products: -
?
S-2444 + H2O
pyroGlu-Gly-Arg + 4-nitroaniline
S2444 + H2O
pyroGlu-Gly-Arg + 4-nitroaniline
-
Substrates: i.e. 5-oxo-L-Pro-Gly-L-Arg-p-nitroanilide
Products: -
?
t-butyloxycarbonyl-valyl-leucyl-lysine-4-methylcoumaryl-7-amide + H2O
Boc-L-Val-L-Leu-L-Lys + 7-amino-4-methylcoumarin
-
Substrates: -
Products: -
?
thrombin + H2O
?
Substrates: -
Products: -
?
urokinase plasminogen activator receptor + H2O
?
YGAKAY + H2O
YGAK + Ala-Tyr
-
Substrates: -
Products: -
?
Z-Gly-Gly-Arg-7-amido-4-methylcoumarin + H2O
Z-Gly-Gly-Arg + 7-amino-4-methylcoumarin
Substrates: -
Products: -
?
Z-RRG-7-amido-4-methylcoumarin + H2O
Z-RRG + 7-amino-4-methylcoumarin
-
Substrates: -
Products: -
?
additional information
?
-
alpha6 integrin + H2O

?
-
Substrates: alpha6 integrin is present on prostate carcinoma escaping the gland via nerves. Urokinase-dependent cleavage of the laminin binding domain from the prostate tumor cell surface
Products: -
?
alpha6 integrin + H2O
?
-
Substrates: i.e. alpha6p
Products: -
?
L-pyroGlu-Gly-L-Arg-4-nitroanilide + H2O

L-pyroGlu-Gly-L-Arg + 4-nitroaniline
-
Substrates: i.e. S-2444
Products: -
?
L-pyroGlu-Gly-L-Arg-4-nitroanilide + H2O
L-pyroGlu-Gly-L-Arg + 4-nitroaniline
-
Substrates: chromogenic substrate S-2444
Products: -
?
plasminogen + H2O

?
-
Substrates: physiological function
Products: -
?
plasminogen + H2O
?
-
Substrates: the enzyme mediates pericellular proteolysis during cell migration and tissue remodelling under physiological and pathophysiological conditions
Products: -
?
plasminogen + H2O
?
-
Substrates: potential role for uPA is a direct regulation of metalloproteinases-mediated extracellular proteolysis via the cleavage of the 72000 MW gelatinase/type IV collagenase to an 62000 MW form
Products: -
?
plasminogen + H2O
?
-
Substrates: key enzyme in the thrombolytic cascade converting plasminogen into plasmin, which in turn degrades thrombus fibrin
Products: -
?
plasminogen + H2O
?
-
Substrates: the enzyme promotes fibrinolysis by catalyzing the conversion of plasminogen to plasmin
Products: -
?
plasminogen + H2O
?
-
Substrates: when localized to the external cell surface it contributes to tissue remodelling and cellular migration
Products: -
?
plasminogen + H2O
?
-
Substrates: physiological function
Products: -
?
plasminogen + H2O
?
-
Substrates: the enzyme is responsible for plasminogen activation, it is also involved in cell adhesion, chemotaxis, and proliferation, the signaling events are not mediated by uPA receptor uPAR/CD87, but require the kringle domain of the enzyme, which binds integrin alphanybeta3 for induction of cell migration, e.g. of CHO cells, overview
Products: -
?
plasminogen + H2O
?
-
Substrates: -
Products: -
?
plasminogen + H2O
?
-
Substrates: physiological function
Products: -
?
plasminogen + H2O

plasmin + ?
A0A337S474
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
651870, 29572, 29573, 29659, 29661, 29662, 29663, 29664, 29666, 29667, 29668, 29669, 29670, 29671, 29673, 29675, 29676 Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: generation of 2 polypeptides, one of 80000 MW (A-chain), and the other of 27000 MW (B-chain)
?
plasminogen + H2O
plasmin + ?
-
Substrates: Glu-plasminogen, the native form of human plasminogen
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: principal function is fibrinolysis, u-PA also been implicated in other physiological functions such as embryogenesis, cell migration, tissue remodeling, ovulation, and wound healing
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: hearts with end-stage failure and fibrosis have macrophage accumulation and elevated plasminogen activator activity, mechanisms that link macrophage accumulation and plasminogen activator activity with cardiac fibrosis, dependent on localization of uPA by the uPA receptor uPAR, on activation of plasminogen by uPA and subsequent activation of transforming growth factor-beta1 and matrix metalloproteinase MMP-2 and MMP-9 by plasmin, overview, uPA-induced cardiac fibrosis can be attenuated by treatment with verapamil, plasminogen is necessary for uPA-induced cardiac fibrosis and macrophage accumulation, but uPAR is not
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: human Glu-plasminogen
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: human plasminogen
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: activation
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: the uPA proteolytic domain specifically cleaves plasminogen and converts it into the serine protease plasmin with wide substrate specificity. Plasmin directly degrades fibrin, leading to thrombus dissolution and activating a number of matrix metalloproteinases
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: u-PA forms a complex with its receptor u-PAR in plasminogen ativation
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: uPA needs to be activated
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: activation
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: casein-plasminogen zymography assay method
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: Glu-plasminogen, the native form of human plasminogen
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: the urokinase-type and tissue-type plasminogen activators regulate liver matrix remodelling through the conversion of plasminogen to the active protease plasmin, uPA is bound to its receptor uPAR, overview
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: human Glu-plasminogen
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: the uPA proteolytic domain specifically cleaves plasminogen and converts it into the serine protease plasmin with wide substrate specificity. Plasmin directly degrades fibrin, leading to thrombus dissolution and activating a number of matrix metalloproteinases
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: the uPA proteolytic domain specifically cleaves plasminogen and converts it into the serine protease plasmin with wide substrate specificity. Plasmin directly degrades fibrin, leading to thrombus dissolution and activating a number of matrix metalloproteinases
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
pro-hepatic growth factor + H2O

mature hepatic growth factor + ?
-
Substrates: uPA activates the hepatic growth factor from its inactive single-chain form to the active alpha-chain form
Products: -
?
pro-hepatic growth factor + H2O
mature hepatic growth factor + ?
-
Substrates: uPA activates the hepatic growth factor from its inactive single-chain form to the active alpha-chain form
Products: -
?
S-2444 + H2O

pyroGlu-Gly-Arg + 4-nitroaniline
-
Substrates: chromogenic substrate
Products: -
?
S-2444 + H2O
pyroGlu-Gly-Arg + 4-nitroaniline
-
Substrates: i.e. pyro-Glu-Gly-Arg-p-nitroanilide, a chromogenic substrate
Products: -
?
S-2444 + H2O
pyroGlu-Gly-Arg + 4-nitroaniline
-
Substrates: chromogenic substrate
Products: -
?
uPAR + H2O

?
Substrates: -
Products: -
?
uPAR + H2O
?
Substrates: urokinase-type plasminogen activator receptor
Products: -
?
urokinase plasminogen activator receptor + H2O

?
-
Substrates: receptor cleavage by u-PA, u-PAR is susceptible to proteolysis by its cognate ligand and several other proteases, biological significance, overview
Products: -
?
urokinase plasminogen activator receptor + H2O
?
-
Substrates: receptor cleavage by u-PA, u-PAR is susceptible to proteolysis by its cognate ligand and several other proteases
Products: -
?
additional information

?
-
Substrates: evaluation of the enzyme's performance for bioluminescence imaging of uPA-overexpressing human breast cancer MDAMB-231 cells, bioluminescence imaging of mice bearing fLuc-transfected MDA-MB-231 tumors, overview
Products: -
-
additional information
?
-
-
Substrates: urokinase-type plasminogen activator includes its single-chain zymogen, pro-urokinase and two-chain enzyme urokinase
Products: -
?
additional information
?
-
-
Substrates: binding of single-chain uPA moiety to its substrate plasminogen occurs with lower affinity compared to binding of the two-chain uPA moiety
Products: -
?
additional information
?
-
-
Substrates: disulfide bridges in the catalytic domain are essential for maintaining amidolytic and fibrinolytic activity
Products: -
?
additional information
?
-
-
Substrates: the enzyme cleaves its cellular receptor between domains 1 and 2
Products: -
?
additional information
?
-
-
Substrates: enzyme released by alveolar epithelial cells alters alveolar epithelial repair in vitro by modulating the underlying fibrin matrix
Products: -
?
additional information
?
-
-
Substrates: active enzyme promotes tumor progression, activation of enzyme appears as a key step in tumor progression
Products: -
?
additional information
?
-
-
Substrates: the enzyme is involved in colorectal cancer invasion and metastasis
Products: -
?
additional information
?
-
-
Substrates: the enzyme plays a major role in extracellular proteolytic events associated with tumor cell growth, migration and angiogenesis
Products: -
?
additional information
?
-
-
Substrates: trans-3,4-dimethyl-3-hydroxyflavanone, a hair growth enhancing active component, decreases active transforming growth factor beta2 and the TGF-b 2 activation cascade through control of uPA on the surface of keratinocytes, mechanism, overview
Products: -
?
additional information
?
-
-
Substrates: the enzyme-plasminogen activator inhibitor-1 complex in intenalized by endocytosis via binding of membrane-bound receptors, overview
Products: -
?
additional information
?
-
-
Substrates: the enzyme is a serine protease involved in tissue remodeling and cell migration, the active form of uPA is bound to its high affinity receptor on the cell surface, where specific inhibitors modulate its enzymatic activity, such inhibitors also regulate the cell surface levels of uPA by triggering the internalization of the uPA-receptor-inhibitor complex via endocytosis, overview, the C-terminus of the N-terminal region contains a sequence that interacts with alphaVbeta3 integrin and is relevant for cell migration, overview
Products: -
?
additional information
?
-
-
Substrates: uPA interacts with the uPA receptor, which is important for many of the enzyme's biological functions
Products: -
?
additional information
?
-
-
Substrates: structure and interdomain contacts of the N-terminal domain of the enzyme with the uPA receptor, binding structure, mechanisms responsible for the cellular responses induced by uPA binding, overview
Products: -
?
additional information
?
-
-
Substrates: structure activity relationship
Products: -
?
additional information
?
-
-
Substrates: the amino-terminal fragment ATF of uPA contains an EGF-like and a kringle domain, involved in the binding of the receptor, chain B contains the catalytic site and maintains the ability to activate plasminogen also when it is not bound to the receptor, the C-terminus of the N-terminal region contains a sequence that interacts with alphaVbeta3 integrin and is relevant for cell migration, overview
Products: -
?
additional information
?
-
-
Substrates: uterine natural killer cells may regulate extravillous trophoblast invasion and spiral artery remodeling via the uPA system
Products: -
?
additional information
?
-
-
Substrates: incubation of THP-1 macrophage-like cells with uPA results in increased expression of paraoxonase 2. The effect requires uPA/uPA receptor interaction and is abolished by cell treatment with antioxidants. Presence of uPA increases macrophage oxidative stress, reactive oxygen formation, superoxide anion release, and cell-mediated low-density lipoprotein oxidation. Effects are related to uPA-mediated activation of NADPH oxidase
Products: -
?
additional information
?
-
-
Substrates: uPA and uPAderived peptides maintaining an amino-terminal fragment growth factor-like domain, including the so-called Omega loop, but not the enzymatically competent low molecular weight fragment, inhibit HIV expression in chronically infected U1 cells stimulated with either phorbol 12-myristate 13-acetate or tumor necrosis factor alpha. Both uPA receptor siRNA ands soluble anti-beta1/beta2 monomclonal antibodies abolish the anti-HIV effects of uPA
Products: -
?
additional information
?
-
-
Substrates: uPA-uPAR complexes concentrate the plasmin production that provides extracellular matrix proteolysis, weakened cell-cell contact, and increased cell motility. The proteolytic mechanisms include uPA-induced plasmin generation at focal adhesion sites, which results in extracellular matrix degradation and thus facilitates the detachment of the cell's trailing edge. Plasmin inhibitors can suppress cell migration both in vitro, mechanisms by which uPA can regulate arterial remodeling, angiogenesis, and cell migration and proliferation after arterial injury, overview. Urokinase signaling, overview
Products: -
?
additional information
?
-
-
Substrates: uPA forms a complex with its cogante receptor uPAR, specific interctions, analysis, overview
Products: -
?
additional information
?
-
-
Substrates: uPA, uPA receptor, and plasminogen activator inhibitor form the urokinase-type plasminogen activator system
Products: -
?
additional information
?
-
-
Substrates: urokinase-type plasmin activator, uPA, binding to uPA receptor, uPAR, induces migration/invasion through multiple interactors including integrins, overview. ECRG2 binds specifically to the kringle domain of uPA, and forms a complex with uPA-uPAR, the trinary complex modifies the dynamical association of uPAR with beta1 integrins. Identification of ECRG2-binding sequence in uPA, overview. Complex disruption inhibits the Src/mitogen-activated protein kinase pathway, resulting in suppression of cell migration/invasion
Products: -
?
additional information
?
-
-
Substrates: uPA-induced phosphorylation of endothelial nitric oxide synthase, eNOS, which is inhibited by myristoylated PKI, a protein kinase A inhibitor
Products: -
?
additional information
?
-
-
Substrates: no activity with the epithelial sodium channel alpha subunit, the enzyme shows amidolytic activity with fluorogenic substrate Pefafluor uPA
Products: -
?
additional information
?
-
Substrates: fibrinolytic activity of single chain urokinase-type plasminogen activator and molecular docking of fungi fibrinolytic compound 1 (FGFC1), a rare marine-derived compound that can enhance fibrinolysis both in vitro and in vivo
Products: -
-
additional information
?
-
-
Substrates: inactive enzyme single-chain precursor (pro-uPA) shows high fibrin specificity. Inactive pro-uPA can directly activate plasminogen without being transformed into uPA
Products: -
-
additional information
?
-
-
Substrates: enzyme protein is consistently elevated in the hyperproliferative hair follicle keratinocyte, and inhibiton of enzyme decreases hair follicle keratinocyte proliferation
Products: -
?
additional information
?
-
-
Substrates: the enzyme supports liver repair independent of its cellular receptor uPAR, overview
Products: -
?
additional information
?
-
-
Substrates: urokinase-type plasminogen activator and macrophages are required for skeletal muscle hypertrophy in mice, depletion of macrophages leads to reduced hypertrophy of muscles, overview
Products: -
?
additional information
?
-
-
Substrates: urokinase-type plasminogen activator plays essential roles in skeletal muscle regeneration and healing, macrophage depletion leads to impaired muscle regeneration, molecular mechanism, overview, the macrophage enzyme is essentially required for chemotaxis, mechanism independent of receptor binding, overview
Products: -
?
additional information
?
-
-
Substrates: recombinant uPA binds purified soluble human integrin alphanybeta3, overview
Products: -
?
additional information
?
-
-
Substrates: induction of endotoxin lipopolysaccharide-mediated uPA receptor expression is mediated through tyrosine phosphorylation of phophoglycerate kinase and heterogenous nuclear ribonucleoprotein C. This involves expression of uPA as an obligate intermediary
Products: -
?
additional information
?
-
-
Substrates: incubation of macrophages with uPA results in increased expression of paraoxonase 2. The resulting effects such as increase in macrophage oxidative stress, reactive oxygen formation, superoxide anion release, and cell-mediated low-density lipoprotein oxidation cannot be reproduced in macrophages harvested from p47phox-/- mice
Products: -
?
additional information
?
-
-
Substrates: addition of uPA to natural killer cell receptor Ly49E positive adult and fetal natural killer cells inhibits interferon-gamma secretion and reduces their cytotoxic potential, respectively. Effects are dependent on receptor Ly49E
Products: -
?
additional information
?
-
-
Substrates: uPA-uPAR complexes concentrate the plasmin production that provides extracellular matrix proteolysis, weakened cell-cell contact, and increased cell motility. The proteolytic mechanisms include uPA-induced plasmin generation at focal adhesion sites, which results in extracellular matrix degradation and thus facilitates the detachment of the cell's trailing edge. Plasmin inhibitors can suppress cell migration both in vitro, mechanisms by which uPA can regulate arterial remodeling, angiogenesis, and cell migration and proliferation after arterial injury, overview. Urokinase signaling, overview
Products: -
?
additional information
?
-
-
Substrates: inhalation of urokinase-type plasminogen activator reduces airway remodeling in a murine asthma model, overview. The uPA/plasmin system participates in pericellular proteolysis and is capable of directly degrading matrix components, activating latent proteinases, and activating growth factors
Products: -
?
additional information
?
-
-
Substrates: inhalation of urokinase-type plasminogen activator reduces airway remodeling in a murine asthma model, overview. The uPA/plasmin system participates in pericellular proteolysis and is capable of directly degrading matrix components, activating latent proteinases, and activating growth factors
Products: -
?
additional information
?
-
-
Substrates: urokinase-type plasminogen activator and macrophages are required for skeletal muscle hypertrophy in mice, depletion of macrophages leads to reduced hypertrophy of muscles, overview
Products: -
?
additional information
?
-
-
Substrates: urokinase-type plasminogen activator plays essential roles in skeletal muscle regeneration and healing, macrophage depletion leads to impaired muscle regeneration, molecular mechanism, overview, the macrophage enzyme is essentially required for chemotaxis, mechanism independent of receptor binding, overview
Products: -
?
additional information
?
-
-
Substrates: lyses fibrin clots containing plasminogen but not plasminogen-free fibrin
Products: -
?
additional information
?
-
-
Substrates: uPA-uPAR complexes concentrate the plasmin production that provides extracellular matrix proteolysis, weakened cell-cell contact, and increased cell motility. The proteolytic mechanisms include uPA-induced plasmin generation at focal adhesion sites, which results in extracellular matrix degradation and thus facilitates the detachment of the cell's trailing edge. Plasmin inhibitors can suppress cell migration both in vitro, mechanisms by which uPA can regulate arterial remodeling, angiogenesis, and cell migration and proliferation after arterial injury, overview. Urokinase signaling, overview
Products: -
?
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
aalpha6beta1 + H2O
?
Substrates: -
Products: -
?
alpha6 integrin + H2O
?
-
Substrates: alpha6 integrin is present on prostate carcinoma escaping the gland via nerves. Urokinase-dependent cleavage of the laminin binding domain from the prostate tumor cell surface
Products: -
?
Fibronectin + H2O
?
Substrates: -
Products: -
?
Gly-Gly-Arg-D-aminoluciferin + H2O
D-aminoluciferin + Gly-Gly-Arg
Substrates: -
Products: -
?
integrin + H2O
?
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
pro-hepatic growth factor + H2O
mature hepatic growth factor + ?
uPAR + H2O
?
Substrates: -
Products: -
?
urokinase plasminogen activator receptor + H2O
?
-
Substrates: receptor cleavage by u-PA, u-PAR is susceptible to proteolysis by its cognate ligand and several other proteases, biological significance, overview
Products: -
?
additional information
?
-
plasminogen + H2O

?
-
Substrates: physiological function
Products: -
?
plasminogen + H2O
?
-
Substrates: the enzyme mediates pericellular proteolysis during cell migration and tissue remodelling under physiological and pathophysiological conditions
Products: -
?
plasminogen + H2O
?
-
Substrates: potential role for uPA is a direct regulation of metalloproteinases-mediated extracellular proteolysis via the cleavage of the 72000 MW gelatinase/type IV collagenase to an 62000 MW form
Products: -
?
plasminogen + H2O
?
-
Substrates: key enzyme in the thrombolytic cascade converting plasminogen into plasmin, which in turn degrades thrombus fibrin
Products: -
?
plasminogen + H2O
?
-
Substrates: the enzyme promotes fibrinolysis by catalyzing the conversion of plasminogen to plasmin
Products: -
?
plasminogen + H2O
?
-
Substrates: when localized to the external cell surface it contributes to tissue remodelling and cellular migration
Products: -
?
plasminogen + H2O
?
-
Substrates: physiological function
Products: -
?
plasminogen + H2O
?
-
Substrates: the enzyme is responsible for plasminogen activation, it is also involved in cell adhesion, chemotaxis, and proliferation, the signaling events are not mediated by uPA receptor uPAR/CD87, but require the kringle domain of the enzyme, which binds integrin alphanybeta3 for induction of cell migration, e.g. of CHO cells, overview
Products: -
?
plasminogen + H2O
?
-
Substrates: physiological function
Products: -
?
plasminogen + H2O

plasmin + ?
A0A337S474
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: principal function is fibrinolysis, u-PA also been implicated in other physiological functions such as embryogenesis, cell migration, tissue remodeling, ovulation, and wound healing
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: hearts with end-stage failure and fibrosis have macrophage accumulation and elevated plasminogen activator activity, mechanisms that link macrophage accumulation and plasminogen activator activity with cardiac fibrosis, dependent on localization of uPA by the uPA receptor uPAR, on activation of plasminogen by uPA and subsequent activation of transforming growth factor-beta1 and matrix metalloproteinase MMP-2 and MMP-9 by plasmin, overview, uPA-induced cardiac fibrosis can be attenuated by treatment with verapamil, plasminogen is necessary for uPA-induced cardiac fibrosis and macrophage accumulation, but uPAR is not
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: activation
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: the uPA proteolytic domain specifically cleaves plasminogen and converts it into the serine protease plasmin with wide substrate specificity. Plasmin directly degrades fibrin, leading to thrombus dissolution and activating a number of matrix metalloproteinases
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: u-PA forms a complex with its receptor u-PAR in plasminogen ativation
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: uPA needs to be activated
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: activation
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: the urokinase-type and tissue-type plasminogen activators regulate liver matrix remodelling through the conversion of plasminogen to the active protease plasmin, uPA is bound to its receptor uPAR, overview
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: the uPA proteolytic domain specifically cleaves plasminogen and converts it into the serine protease plasmin with wide substrate specificity. Plasmin directly degrades fibrin, leading to thrombus dissolution and activating a number of matrix metalloproteinases
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: the uPA proteolytic domain specifically cleaves plasminogen and converts it into the serine protease plasmin with wide substrate specificity. Plasmin directly degrades fibrin, leading to thrombus dissolution and activating a number of matrix metalloproteinases
Products: -
?
plasminogen + H2O
plasmin + ?
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
Substrates: -
Products: -
?
plasminogen + H2O
plasmin + ?
-
Substrates: -
Products: -
?
pro-hepatic growth factor + H2O

mature hepatic growth factor + ?
-
Substrates: uPA activates the hepatic growth factor from its inactive single-chain form to the active alpha-chain form
Products: -
?
pro-hepatic growth factor + H2O
mature hepatic growth factor + ?
-
Substrates: uPA activates the hepatic growth factor from its inactive single-chain form to the active alpha-chain form
Products: -
?
additional information

?
-
-
Substrates: enzyme released by alveolar epithelial cells alters alveolar epithelial repair in vitro by modulating the underlying fibrin matrix
Products: -
?
additional information
?
-
-
Substrates: active enzyme promotes tumor progression, activation of enzyme appears as a key step in tumor progression
Products: -
?
additional information
?
-
-
Substrates: the enzyme is involved in colorectal cancer invasion and metastasis
Products: -
?
additional information
?
-
-
Substrates: the enzyme plays a major role in extracellular proteolytic events associated with tumor cell growth, migration and angiogenesis
Products: -
?
additional information
?
-
-
Substrates: trans-3,4-dimethyl-3-hydroxyflavanone, a hair growth enhancing active component, decreases active transforming growth factor beta2 and the TGF-b 2 activation cascade through control of uPA on the surface of keratinocytes, mechanism, overview
Products: -
?
additional information
?
-
-
Substrates: the enzyme-plasminogen activator inhibitor-1 complex in intenalized by endocytosis via binding of membrane-bound receptors, overview
Products: -
?
additional information
?
-
-
Substrates: the enzyme is a serine protease involved in tissue remodeling and cell migration, the active form of uPA is bound to its high affinity receptor on the cell surface, where specific inhibitors modulate its enzymatic activity, such inhibitors also regulate the cell surface levels of uPA by triggering the internalization of the uPA-receptor-inhibitor complex via endocytosis, overview, the C-terminus of the N-terminal region contains a sequence that interacts with alphaVbeta3 integrin and is relevant for cell migration, overview
Products: -
?
additional information
?
-
-
Substrates: uPA interacts with the uPA receptor, which is important for many of the enzyme's biological functions
Products: -
?
additional information
?
-
-
Substrates: structure and interdomain contacts of the N-terminal domain of the enzyme with the uPA receptor, binding structure, mechanisms responsible for the cellular responses induced by uPA binding, overview
Products: -
?
additional information
?
-
-
Substrates: uterine natural killer cells may regulate extravillous trophoblast invasion and spiral artery remodeling via the uPA system
Products: -
?
additional information
?
-
-
Substrates: incubation of THP-1 macrophage-like cells with uPA results in increased expression of paraoxonase 2. The effect requires uPA/uPA receptor interaction and is abolished by cell treatment with antioxidants. Presence of uPA increases macrophage oxidative stress, reactive oxygen formation, superoxide anion release, and cell-mediated low-density lipoprotein oxidation. Effects are related to uPA-mediated activation of NADPH oxidase
Products: -
?
additional information
?
-
-
Substrates: uPA-uPAR complexes concentrate the plasmin production that provides extracellular matrix proteolysis, weakened cell-cell contact, and increased cell motility. The proteolytic mechanisms include uPA-induced plasmin generation at focal adhesion sites, which results in extracellular matrix degradation and thus facilitates the detachment of the cell's trailing edge. Plasmin inhibitors can suppress cell migration both in vitro, mechanisms by which uPA can regulate arterial remodeling, angiogenesis, and cell migration and proliferation after arterial injury, overview. Urokinase signaling, overview
Products: -
?
additional information
?
-
-
Substrates: uPA forms a complex with its cogante receptor uPAR, specific interctions, analysis, overview
Products: -
?
additional information
?
-
-
Substrates: uPA, uPA receptor, and plasminogen activator inhibitor form the urokinase-type plasminogen activator system
Products: -
?
additional information
?
-
-
Substrates: urokinase-type plasmin activator, uPA, binding to uPA receptor, uPAR, induces migration/invasion through multiple interactors including integrins, overview. ECRG2 binds specifically to the kringle domain of uPA, and forms a complex with uPA-uPAR, the trinary complex modifies the dynamical association of uPAR with beta1 integrins. Identification of ECRG2-binding sequence in uPA, overview. Complex disruption inhibits the Src/mitogen-activated protein kinase pathway, resulting in suppression of cell migration/invasion
Products: -
?
additional information
?
-
-
Substrates: uPA-induced phosphorylation of endothelial nitric oxide synthase, eNOS, which is inhibited by myristoylated PKI, a protein kinase A inhibitor
Products: -
?
additional information
?
-
Substrates: fibrinolytic activity of single chain urokinase-type plasminogen activator and molecular docking of fungi fibrinolytic compound 1 (FGFC1), a rare marine-derived compound that can enhance fibrinolysis both in vitro and in vivo
Products: -
-
additional information
?
-
-
Substrates: enzyme protein is consistently elevated in the hyperproliferative hair follicle keratinocyte, and inhibiton of enzyme decreases hair follicle keratinocyte proliferation
Products: -
?
additional information
?
-
-
Substrates: the enzyme supports liver repair independent of its cellular receptor uPAR, overview
Products: -
?
additional information
?
-
-
Substrates: urokinase-type plasminogen activator and macrophages are required for skeletal muscle hypertrophy in mice, depletion of macrophages leads to reduced hypertrophy of muscles, overview
Products: -
?
additional information
?
-
-
Substrates: urokinase-type plasminogen activator plays essential roles in skeletal muscle regeneration and healing, macrophage depletion leads to impaired muscle regeneration, molecular mechanism, overview, the macrophage enzyme is essentially required for chemotaxis, mechanism independent of receptor binding, overview
Products: -
?
additional information
?
-
-
Substrates: induction of endotoxin lipopolysaccharide-mediated uPA receptor expression is mediated through tyrosine phosphorylation of phophoglycerate kinase and heterogenous nuclear ribonucleoprotein C. This involves expression of uPA as an obligate intermediary
Products: -
?
additional information
?
-
-
Substrates: incubation of macrophages with uPA results in increased expression of paraoxonase 2. The resulting effects such as increase in macrophage oxidative stress, reactive oxygen formation, superoxide anion release, and cell-mediated low-density lipoprotein oxidation cannot be reproduced in macrophages harvested from p47phox-/- mice
Products: -
?
additional information
?
-
-
Substrates: addition of uPA to natural killer cell receptor Ly49E positive adult and fetal natural killer cells inhibits interferon-gamma secretion and reduces their cytotoxic potential, respectively. Effects are dependent on receptor Ly49E
Products: -
?
additional information
?
-
-
Substrates: uPA-uPAR complexes concentrate the plasmin production that provides extracellular matrix proteolysis, weakened cell-cell contact, and increased cell motility. The proteolytic mechanisms include uPA-induced plasmin generation at focal adhesion sites, which results in extracellular matrix degradation and thus facilitates the detachment of the cell's trailing edge. Plasmin inhibitors can suppress cell migration both in vitro, mechanisms by which uPA can regulate arterial remodeling, angiogenesis, and cell migration and proliferation after arterial injury, overview. Urokinase signaling, overview
Products: -
?
additional information
?
-
-
Substrates: inhalation of urokinase-type plasminogen activator reduces airway remodeling in a murine asthma model, overview. The uPA/plasmin system participates in pericellular proteolysis and is capable of directly degrading matrix components, activating latent proteinases, and activating growth factors
Products: -
?
additional information
?
-
-
Substrates: inhalation of urokinase-type plasminogen activator reduces airway remodeling in a murine asthma model, overview. The uPA/plasmin system participates in pericellular proteolysis and is capable of directly degrading matrix components, activating latent proteinases, and activating growth factors
Products: -
?
additional information
?
-
-
Substrates: urokinase-type plasminogen activator and macrophages are required for skeletal muscle hypertrophy in mice, depletion of macrophages leads to reduced hypertrophy of muscles, overview
Products: -
?
additional information
?
-
-
Substrates: urokinase-type plasminogen activator plays essential roles in skeletal muscle regeneration and healing, macrophage depletion leads to impaired muscle regeneration, molecular mechanism, overview, the macrophage enzyme is essentially required for chemotaxis, mechanism independent of receptor binding, overview
Products: -
?
additional information
?
-
-
Substrates: uPA-uPAR complexes concentrate the plasmin production that provides extracellular matrix proteolysis, weakened cell-cell contact, and increased cell motility. The proteolytic mechanisms include uPA-induced plasmin generation at focal adhesion sites, which results in extracellular matrix degradation and thus facilitates the detachment of the cell's trailing edge. Plasmin inhibitors can suppress cell migration both in vitro, mechanisms by which uPA can regulate arterial remodeling, angiogenesis, and cell migration and proliferation after arterial injury, overview. Urokinase signaling, overview
Products: -
?
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
1-[(N-benzylsulfonyl-D-seryl)-L-alanyl]amino-2-(4-guanidinophenyl)ethanephosphonate trifluoroacetate
-
-
1-[3'-([3,5-difluoro-6-[5-methyl-2-(1H-tetrazol-1-yl)phenoxy]pyridin-2-yl]oxy)biphenyl-3-yl]methanamine
-
-
2-(1-hydroxynaphthalen-2-yl)-1-H-benzoimidazole-5-carboxamidine
-
-
2-(2,6-dihydroxyphenyl)-1-H-benzoimidazole-5-carboxamidine
-
-
2-(2-hydroxy-3-bromo-5-methylphenyl)-1-H-benzoimidazole-5-carboxamidine
-
-
2-(2-hydroxy-3-bromophenyl)-1-H-benzoimidazole-5-carboxamidine
-
-
2-(2-hydroxy-3-fluorophenyl)-1-H-benzoimidazole-5-carboxamidine
-
-
2-(2-hydroxy-3-methoxyphenyl)-1-H-benzoimidazole-5-carboxamidine
-
-
2-(2-hydroxy-3-methylphenyl)-1-H-benzoimidazole-5-carboxamidine
-
-
2-(2-hydroxy-3-nitrophenyl)-1-H-benzoimidazole-5-carboxamidine
-
-
2-(2-hydroxy-4-diethylaminophenyl)-1-H-benzoimidazole-5-carboxamidine
-
-
2-(2-hydroxy-4-methylphenyl)-1-H-benzoimidazole-5-carboxamidine
-
-
2-(2-hydroxy-5-bromophenyl)-1-H-benzoimidazole-5-carboxamidine
-
-
2-(2-hydroxy-5-chlorobiphenyl-3-yl)-1-H-benzoimidazole-5-carboxamidine
-
-
2-(2-hydroxy-5-fluorophenyl)-1-H-benzoimidazole-5-carboxamidine
-
-
2-(2-hydroxy-5-methoxyphenyl)-1-H-benzoimidazole-5-carboxamidine
-
-
2-(2-hydroxy-5-methylphenyl)-1-H-benzoimidazole-5-carboxamidine
-
-
2-(2-hydroxy-5-nitrophenyl)-1-H-benzoimidazole-5-carboxamidine
-
-
2-(2-hydroxybiphenyl-3-yl)-1-H-benzoimidazole-5-carboxamidine
-
-
2-(2-hydroxyphenyl)-1-H-benzoimidazole-5-carboxamidine
-
-
2-(2-hydroxyphenyl)1H-benzoimidazole-5-carboxamidine
-
-
2-(4-chloro-7-(2-cyano-6-methoxyphenyl)isoquinolin-1-yl)guanidine
-
comparison of selectivity with t-plasminogen activator and plasmin
2-(4-chloro-7-(2-methoxyphenyl)isoquinolin-1-yl)guanidine
-
comparison of selectivity with t-plasminogen activator and plasmin
2-(4-chloro-7-(3-methoxyphenyl)isoquinolin-1-yl)guanidine
-
comparison of selectivity with t-plasminogen activator and plasmin
2-(7-(1,3-benzodioxol-5-yl)-4-chloroisoquinolin-1-yl)guanidine
-
comparison of selectivity with t-plasminogen activator and plasmin
2-(7-(1,3-benzodioxol-5-yl)isoquinolin-1-yl)guanidine
-
comparison of selectivity with t-plasminogen activator and plasmin
2-(7-phenylisoquinolin-1-yl)guanidine
-
comparison of selectivity with t-plasminogen activator and plasmin
2-([6-[(3'-carbamimidoylbiphenyl-3-yl)oxy]-3,5-difluoro-4-methylpyridin-2-yl]oxy)-4-(dimethylamino)benzoic acid
2-phenethyl-SO2-D-Ser-Ala-Arg-al
-
is an irreversible urokinase inhibitor, and an alkylating agent forming a covalent adduct with an active site of the enzyme
2-phenyl-1-H-benzoimidazole-5-carboxamidine
-
-
2-[(6-[[3',5-bis(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-methylbenzoic acid
-
-
2-[(6-[[3'-(aminomethyl)-5-hydroxybiphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-methylbenzoic acid
-
-
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-3-methylbenzoic acid
-
-
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-(dimethylamino)benzoic acid
-
-
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-(propan-2-yl)benzoic acid
-
-
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-methoxybenzoic acid
-
-
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-methylbenzoic acid
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-nitrobenzoic acid
-
-
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-5-methylbenzoic acid
-
-
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-6-methylbenzoic acid
-
-
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]benzoic acid
-
-
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-4-[3-(dimethylamino)pyrrolidin-1-yl]-3,5-difluoropyridin-2-yl)oxy]-4-(dimethylamino)benzoic acid
-
-
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-4-[[2-(dimethylamino)ethyl](methyl)amino]-3,5-difluoropyridin-2-yl)oxy]-4-(dimethylamino)benzoic acid
-
-
2-[(6-[[4'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-(dimethylamino)benzoic acid
-
-
2-[(6-[[4-amino-3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-methylbenzoic acid
-
-
2-[(6-[[5-amino-3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-methylbenzoic acid
2-[(6-[[5-amino-3'-(aminomethyl)biphenyl-3-yl]oxy]-4-[3-(dimethylamino)pyrrolidin-1-yl]-3,5-difluoropyridin-2-yl)oxy]-4-methylbenzoic acid
-
-
2-[(6-[[6-amino-3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-methylbenzoic acid
-
-
2-[2-(7-amino-4-chloro-1-oxo-1H-isochromen-3-yloxy)ethyl]isothiourea hydrobromide
-
-
2-[2-(7-benzamido-4-chloro-1-oxo-1H-isochromen-3-yloxy)ethyl]isothiourea hydrobromide
-
-
2-[3-(7-amino-4-chloro-1-oxo-1H-isochromen-3-yloxy)propyl]isothiourea hydrobromide
-
-
2-[3-(7-benzamido-4-chloro-1-oxo-1H-isochromen-3-yloxy]propyl)isothiourea hydrobromide
-
-
2-[[3,5-difluoro-6-([3'-[(methylamino)methyl]biphenyl-3-yl]oxy)pyridin-2-yl]oxy]-4-(dimethylamino)benzoic acid
-
-
2-[[6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoro-4-(methylamino)pyridin-2-yl]oxy]-4-(dimethylamino)benzoic acid
-
-
2-[[6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoro-4-(morpholin-4-yl)pyridin-2-yl]oxy]-4-(dimethylamino)benzoic acid
-
-
2-[[6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoro-4-(piperazin-1-yl)pyridin-2-yl]oxy]-4-(dimethylamino)benzoic acid
-
-
2-[[6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-4-(dimethylamino)-3,5-difluoropyridin-2-yl]oxy]-4-(dimethylamino)benzoic acid
-
-
3,5-diamino-6-(1-benzofuran-2-yl)-N-carbamimidoylpyrazine-2-carboxamide
inhibits uPA, but shows no or poor inhibition of tPA, plasmin, thrombin, trypsin, plasma kallikrein, FXa, FXla, and activated protein C
3,5-diamino-6-(1-benzofuran-5-yl)-N-carbamimidoylpyrazine-2-carboxamide
-
3,5-diamino-6-(1-benzothiophen-2-yl)-N-carbamimidoylpyrazine-2-carboxamide
-
3,5-diamino-6-(5-bromo-1-benzofuran-2-yl)-N-carbamimidoylpyrazine-2-carboxamide
-
3,5-diamino-N-carbamimidoyl-6-(1-methyl-1H-pyrazol-4-yl)pyrazine-2-carboxamide
-
3,5-diamino-N-carbamimidoyl-6-(2,3-dihydro-1-benzofuran-5-yl)pyrazine-2-carboxamide
-
3,5-diamino-N-carbamimidoyl-6-(2,4-dimethoxypyrimidin-5-yl)pyrazine-2-carboxamide
-
3,5-diamino-N-carbamimidoyl-6-(2,6-dimethoxypyridin-3-yl)pyrazine-2-carboxamide
-
3,5-diamino-N-carbamimidoyl-6-(2-methoxypyrimidin-5-yl)pyrazine-2-carboxamide
-
3,5-diamino-N-carbamimidoyl-6-(5-chloro-1-benzofuran-2-yl)pyrazine-2-carboxamide
-
3,5-diamino-N-carbamimidoyl-6-(5-cyano-1-benzofuran-2-yl)pyrazine-2-carboxamide
-
3,5-diamino-N-carbamimidoyl-6-(5-fluoro-1-benzofuran-2-yl)pyrazine-2-carboxamide
-
3,5-diamino-N-carbamimidoyl-6-(5-methoxy-1-benzofuran-2-yl)pyrazine-2-carboxamide
-
3,5-diamino-N-carbamimidoyl-6-(5-methyl-1-benzofuran-2-yl)pyrazine-2-carboxamide
-
3,5-diamino-N-carbamimidoyl-6-(6-methoxy-1-benzofuran-2-yl)pyrazine-2-carboxamide
-
3,5-diamino-N-carbamimidoyl-6-(furan-2-yl)pyrazine-2-carboxamide
-
3,5-diamino-N-carbamimidoyl-6-(furan-3-yl)pyrazine-2-carboxamide
-
3,5-diamino-N-carbamimidoyl-6-(pyrimidin-5-yl)pyrazine-2-carboxamide
-
3,5-diamino-N-carbamimidoyl-6-(thiophen-2-yl)pyrazine-2-carboxamide
-
3,5-diamino-N-carbamimidoyl-6-chloropyrazine-2-carboxamide
3,5-diamino-N-carbamimidoyl-6-phenylpyrazine-2-carboxamide
-
3,5-diamino-N-carbamimidoyl-6-[4-(methylsulfanyl)phenyl]pyrazine-2-carboxamide
-
3,5-diamino-N-carbamimidoyl-6-[4-(trifluoromethyl)phenyl]pyrazine-2-carboxamide
-
3-(1-carbamimidoylpiperidin-3-yl)-L-alanine
3-(1-carbamimidoylpiperidin-4-yl)-L-alanine
3-(2-bromoethoxy)-7-nitro-1H-isochromen-1-one
-
-
3-(3-bromopropoxy)-4-trifluoroacetyl-1H-isochromen-1-one
-
-
3-(3-bromopropoxy)-7-nitro-1H-isochromen-1-one
-
-
3-(4-chloro-1-((diaminomethylene)amino)isoquinolin-7-yl)-5-methoxybenzoic acid
-
comparison of selectivity with t-plasminogen activator and plasmin
3-(4-chloro-1-((diaminomethylene)amino)isoquinolin-7-yl)benzoic acid
-
comparison of selectivity with t-plasminogen activator and plasmin
3-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]benzoic acid
-
-
3-[2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]phenyl]propanoic acid
-
-
4'-(6-cyano-2-naphthamido)biphenyl-3-carboxylic acid
slight inhibition
4'-(6-methoxynaphthalene-2-sulfonamido)biphenyl-3-carboxamide
slight inhibition
4-(2-aminoethoxy)-N-(3-chloro-2-ethoxy-5-piperidin-1-ylphenyl)-3,5-dimethylbenzamide
-
inhibitor with moderate clearance level, high volume of distribution, and long half-life of 7.5 hours. More than 50 fold selective for uPA over all but one of the enzymes tested. Selectivity against trypsin is only 3- to 4fold
4-(2-aminoethoxy)-N-[3-chloro-2-ethoxy-5-(piperidin-1-yl)phenyl]-3,5-dimethylbenzamide
-
4-(4-chloro-1-((diaminomethylene)amino)isoquinolin-7-yl)benzoic acid
-
comparison of selectivity with t-plasminogen activator and plasmin
4-(dimethylamino)-2-[[6-([3'-[(dimethylamino)methyl]biphenyl-3-yl]oxy)-3,5-difluoropyridin-2-yl]oxy]benzoic acid
-
-
4-aminobenzamidine
-
competitive, no inhibition of the pro-uPA
4-chloro-3-alkoxyisocoumarin
-
competitive reversible inhibition
4-iodobenzo[b]thiophene-2-carboxamidine
-
APC-6860, competitive inhibition
4-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]benzoic acid
-
-
4-[(E)-(5-oxo-2-phenyl-1,3-oxazol-4(5H)-ylidene)methyl]benzenecarboximidamide
-
6-(phenylcarbamoyl)-2-naphthoic acid
slight inhibition
6-amino-N-phenyl-2-naphthamide
slight inhibition
6-bromo-N-phenyl-2-naphthamide
slight inhibition
6-carbamimidoyl-N-(3,5-dimethoxyphenyl)-2-naphthamide
-
6-carbamimidoyl-N-phenyl-2-naphthamide
-
6-carbamimidoyl-N-phenyl-5,8-dihydronaphthalene-2-carboxamide
-
6-cyano-N-(3'-methoxybiphenyl-4-yl)-2-naphthamide
-
6-cyano-N-(3,5-dimethoxyphenyl)-2-naphthamide
-
6-cyano-N-phenylnaphthalene-2-carboxamide
slight inhibition
6-methoxy-N-(3'-(trifluoromethyl)biphenyl-4-yl)-2-naphthamide
-
6-methoxy-N-(3'-(trifluoromethyl)biphenyl-4-yl)naphthalene-2-sulfonamide
-
6-methoxy-N-(3'-methoxybiphenyl-4-yl)-2-naphthamide
-
6-methoxy-N-(3'-methoxybiphenyl-4-yl)naphthalene-2-sulfonamide
-
6-methoxy-N-(3'-nitrobiphenyl-4-yl)-2-naphthamide
-
6-methoxy-N-(3'-nitrobiphenyl-4-yl)naphthalene-2-sulfonamide
-
6-methoxy-N-(4'-methoxybiphenyl-4-yl)-2-naphthamide
-
6-methoxy-N-(4'-methoxybiphenyl-4-yl)naphthalene-2-sulfonamide
-
6-methoxy-N-phenyl-2-naphthamide
slight inhibition
7-amino-3-(2-bromoethoxy)-1H-isochromen-1-one
-
-
7-methoxy-8-[1-(methylsulfonyl)-1H-pyrazol-4-yl]naphthalene-2-carboximidamide
-
alpha-1-antitrypsin
-
-
-
alpha-1-Proteinase inhibitor
-
-
-
alpha-2-Macroglobulin
-
-
-
alpha-Benzylsulfonyl-p-aminophenylalanine
-
-
antibody DS2
-
isolation and affinity maturation of a fully human recombinant antibody, that is specific to the human uPA and capable of inhibiting its enzymatic activity with an IC50 value in the low nanomolar range, overview. Ability of the DS2 antibody to preferentially localize at the tumor site compared with healthy organs
-
antibody mU3
-
binding of mU3 to the 37- and 70-loops, the antibody stabilizes the active conformation of the enzyme, the N-terminus (Ile16) of the truncated enzyme muPA(16-243) is less exposed upon binding of mU3
-
benzo[b]thiophene-2-carboxamidine
-
APC-7377
bis[(phenylamino)acetyl] [2-(4-carbamimidamidophenyl)-1-[(methoxycarbonyl)amino]ethyl]phosphonate
-
D-Ser-Ala-Arg-NH-(CH2)5-NH2
-
competitive inhibition
D-Ser-Ala-Arg-NH-(CH2)7-NH2
-
-
D-Ser-Ala-Arg-NH-(CH2)8-NH2
-
-
D-Ser-Ala-Arg-NH-(CH2)9-NH2
-
-
di-(4-acetamidophenyl) 1-[(N-benzyloxycarbonyl-D-seryl)-Lalanyl]amino-2-[4-(guanidino)phenyl]-ethanephosphonate trifluoroacetate
-
-
diphenyl (N-benzyloxycarbonyl-D-seryl-L-alanyl)amino-(3-guanylpropyl)methanephosphonate
-
50% inhibition at 0.000061 mM
diphenyl (N-benzyloxycarbonyl-D-seryl-L-alanyl)amino-(4-guanylbutyl)methanephosphonate
-
50% inhibition at 0.00025 mM
diphenyl (N-benzyloxycarbonyl-D-seryl-L-alanyl)amino-(4-guanylphenyl)methanephosphonate
-
50% inhibition at 0.0016 mM
diphenyl 1-(N-benzyloxycarbonyl-D-seryl-L-alanyl)amino-2-(4-guanylphenyl)ethanephosphonate
-
50% inhibition at 0.000057 mM
diphenyl 1-[(N-2-acetoadamantanyl-D-seryl)-L-alanyl]amino-2-(4-guanidinophenyl)ethanephosphonate trifluoroacetate
-
-
diphenyl 1-[(N-2-acetothiophenyl-D-seryl)-L-alanyl]amino-2-(4-guanidinophenyl)ethanephosphonate trifluoroacetate
-
-
diphenyl 1-[(N-benzenesulfonyl-D-seryl)-L-alanyl]amino-2-(4-guanidinophenyl)ethanephosphonate trifluoroacetate
-
-
diphenyl 1-[(N-benzoyloxycarbonyl-D-seryl)-L-alanyl]amino-2-(4-guanidinophenyl)ethanephosphonate trifluoroacetate
-
-
diphenyl 1-[(N-benzoylsulfonyl-D-seryl)-L-alanyl]amino-2-(4-guanidinophenyl)ethanephosphonate trifluoroacetate
-
-
diphenyl 1-[(N-naphtalenesulfonyl-D-seryl)-L-alanyl]amino-2-(4-guanidinophenyl)ethanephosphonate trifluoroacetate
-
-
diphenyl 1-[(N-o,o-dimethylbenzoyl-D-seryl)-L-alanyl]amino-2-(4-guanidinophenyl)ethanephosphonate trifluoroacetate
-
-
diphenyl 1-[(N-o-methylbenzoyl-D-seryl)-L-alanyl]amino-2-(4-guanidinophenyl)ethanephosphonate trifluoroacetate
-
-
diphenyl 1-[(N-p-bromobenzenesulfonyl-D-seryl)-L-alanyl]-amino-2-(4-guanidinophenyl)ethane-phosphonate trifluoroacetate
-
-
diphenyl 1-[(N-p-cyanobenzenesulfonyl-D-seryl)-L-alanyl]-amino-2-(4-guanidinophenyl)ethane-phosphonate trifluoroacetate
-
-
diphenyl 1-[(N-p-methoxybenzenesulfonyl-D-seryl)-L-alanyl]-amino-2-(4-guanidinophenyl)ethane-phosphonate trifluoroacetate
-
-
diphenyl 1-[(N-p-methylbenzoyl-D-seryl)-L-alanyl]amino-2-(4-guanidinophenyl)ethanephosphonate trifluoroacetate
-
-
diphenyl 1-[(N2-thiophenesulfonyl-D-seryl)-L-alanyl]amino-2-(4-guanidinophenyl)ethanephosphonate trifluoroacetate
-
-
diphenyl [2-(4-carbamimidamidophenyl)-1-[(methoxycarbonyl)amino]ethyl]phosphonate
-
DNA aptamers
highly affine and specific DNA aptamers of up to 82-nt long that can bind to different forms of human uPA are identified. Single-stranded DNA (ssDNA) aptamers are isolated by systematic evolution of ligands by exponential enrichment (SELEX) from a 42-nt random ssDNA-library with a theoretical diversity of 1.9 x 1025 different sequences. Enzyme binding analysis and kinetics, detailed overview. No inhibition by aptamers uPAapt-08 (CAGCGGTAGGGGTTATATAGCTGCGCCATAGGGTACTCGTG), uPAapt-26 (ATCCGTGGCGTGGTTGGTGGGGGAGGTGGGCGGGTAGACGGT), and uPAapt-27 (ATGGGGTGTTATGGGGGGGGCTTATTGCGGTCAGGGGACGAT)
-
EDTA
-
inhibits binding of integrin alphanybeta3 to the enzyme
Endothelial cell/platelet type plasminogen activator inhibitor
-
-
-
enzyme-specific antibody
-
significant reduction of hair follicle keratinocyte proliferation
-
ethyl 4-(3-carbamimidoyl-N-[[2,4,6-tri(propan-2-yl)phenyl]sulfonyl]-L-phenylalanyl)piperazine-1-carboxylate
-
Fast-acting uPA inhibitor in plasma
-
-
-
Glu-Gly-Arg chloromethyl ketone
-
-
Glu-Gly-Arg-chloromethyl ketone
-
-
human PAI-1
human plasminogen activator inhibitor-1, complex structure of uPA:PAI-1 Michaelis complex, interaction analysis, the S3-pocket-lining residues of uPA and the P3 residue of both PAI-1 and plasminogen form numerous polar interactions in the human uPA:PAI-1 Michaelis complex, overview
-
i-Boc-D-Ser-Ala-Arg-al
-
is an alkylating agent, and irreversibly inhibits urokinase by forming a covalent adduct with an active site of the enzyme
Lima bean trypsin inhibitor
-
-
-
maspin
-
regulates uPA-dependent processes in vivo not involving its RCL sequence with Arg340, but is inable to directly inhibit uPA catalytic activity in vitro, binds the enzyme in both singlechain and double-chain forms, maspin is a member of the serpin family with a reactive center loop that is incompatible with proteinase inhibition by the serpin conformational change mechanism, overview
meloxicam
-
reduces enzyme secretion in chondral and synovial cultures downregulating the PA/plasmin system
methyl 3,5-diamino-6-chloropyrazine-2-carboxylate
-
methyl 4'-(2-naphthamido)biphenyl-3-carboxylate
-
methyl 4'-(6-amino-2-naphthamido)biphenyl-3-carboxylate
-
methyl 4'-(6-bromo-2-naphthamido)biphenyl-3-carboxylate
-
methyl 4'-(6-carbamoyl-2-naphthamido)biphenyl-3-carboxylate
-
methyl 4'-(6-chloro-2-naphthamido)biphenyl-3-carboxylate
-
methyl 4'-(6-cyano-2-naphthamido)biphenyl-3-carboxylate
-
methyl 4'-(6-methoxy-2-naphthamido)biphenyl-3-carboxylate
-
methyl 4'-(6-methoxynaphthalene-2-sulfonamido)biphenyl-3-carboxylate
-
methyl 4'-(6-methoxynaphthalene-2-sulfonamido)biphenyl-4-carboxylate
-
methyl 4'-(naphthalene-2-sulfonamido)biphenyl-3-carboxylate
-
methyl 4'-(naphthalene-2-sulfonamido)biphenyl-4-carboxylate
-
methyl 6-(3'-(methoxycarbonyl)biphenyl-4-ylcarbamoyl)-2-naphthoate
-
methyl 6-(phenylcarbamoyl)-2-naphthoate
slight inhibition
methylprednisolone
-
reduces enzyme secretion in chondral and synovial cultures downregulating the PA/plasmin system
mexiletine
-
IC50 value above 1 mM, crystallographic data
monoclonal antibody mU1
-
murine monoclonal antibody directed against murine uPA. mU1 blocks uPA-catalyzed plasminogen activation in vitro, as well as plasmin-mediated pro-uPA activation. Systemic administration of mU1 rescues mice treated with a uPA-activable anthrax protoxi and impairs uPA-mediated hepatic fibrinolysis in tissue-type plasminogen activator-deficient mice, resulting in a phenotype mimicking that of uPA/tPA double deficient mice
-
mupain-1-16
-
the inhibitor stabilizes the active conformation of the enzyme, the N-terminus (Ile16) of the truncated enzyme muPA(16-243) is less exposed upon binding of mupain-1-16
myristoylated PKI
-
mPLI, a protein kinase A inhibitor, complete inhibition
-
N-(2,4'-dimethoxybiphenyl-4-yl)-6-methoxynaphthalene-2-sulfonamide
-
N-(2,4-dimethoxybiphenyl-4-yl)-6-methoxy-2-naphthamide
slight inhibition
N-(3',4'-dimethoxybiphenyl-4-yl)-6-methoxy-2-naphthamide
-
N-(3',4'-dimethoxybiphenyl-4-yl)-6-methoxynaphthalene-2-sulfonamide
-
N-(3'-aminobiphenyl-4-yl)-6-methoxynaphthalene-2-sulfonamide
-
N-(3'-chlorobiphenyl-4-yl)-6-methoxynaphthalene-2-sulfonamide
slight inhibition
N-(3'-fluorobiphenyl-4-yl)-6-methoxynaphthalene-2-sulfonamide
slight inhibition
N-(3'-methoxybiphenyl-4-yl)-2-naphthamide
-
N-(3'-methoxybiphenyl-4-yl)naphthalene-2-sulfonamide
-
N-(4-(aminomethyl)phenyl)-6-carbamimidoyl-2-naphthamide trifluoro acetate
-
N-(benzylsulfonyl)-D-seryl-N-(4-carbamimidoylbenzyl)-L-alaninamide
N-(benzylsulfonyl)-D-seryl-N-(4-carbamimidoylbenzyl)-L-prolinamide
comparison of specificity with five additional trypsin-like serine-proteases
N-(benzylsulfonyl)-D-seryl-N-(4-carbamimidoylbenzyl)-L-serinamide
comparison of specificity with five additional trypsin-like serine-proteases
N-(benzylsulfonyl)-D-seryl-N-(4-carbamimidoylbenzyl)glycinamide
comparison of specificity with five additional trypsin-like serine-proteases
N-(biphenyl-4-yl)-6-methoxynaphthalene-2-sulfonamide
-
N-phenyl-2-naphthamide
slight inhibition
N-[(4-aminobenzyl)sulfonyl]-D-seryl-N-(4-carbamimidoylbenzyl)glycinamide
comparison of specificity with five additional trypsin-like serine-proteases
N-[(4-chlorobenzyl)sulfonyl]-D-seryl-N-(4-carbamimidoylbenzyl)-L-alaninamide
comparison of specificity with five additional trypsin-like serine-proteases
N-[(4-chlorobenzyl)sulfonyl]-D-seryl-N-(4-carbamimidoylbenzyl)-L-serinamide
comparison of specificity with five additional trypsin-like serine-proteases
N-[(4-methylbenzyl)sulfonyl]-D-seryl-N-(4-carbamimidoylbenzyl)-L-alaninamide
comparison of specificity with five additional trypsin-like serine-proteases
N-[(4-nitrobenzyl)sulfonyl]-D-seryl-N-(4-carbamimidoylbenzyl)glycinamide
comparison of specificity with five additional trypsin-like serine-proteases
N-[3-(2-bromoethoxy)-4-chloro-1-oxo-1H-isochromen-7-yl]benzamide
-
-
N-[3-(3-bromopropoxy)-4-chloro-1-oxo-1H-isochromen-7-yl]benzamide
-
competitive reversible inhibition mechanism, the bromine occupies the same position as positively charged arginino mimetic groups, molecular modeling
N-[4-(aminomethyl)phenyl]-6-carbamimidoyl-4-(pyrimidin-2-ylamino)naphthalene-2-carboxamide
-
N-[[4-(methoxycarbonyl)benzyl]sulfonyl]-D-seryl-N-(4-carbamimidoylbenzyl)-L-alaninamide
comparison of specificity with five additional trypsin-like serine-proteases
N2-(2,4'-dimethoxybiphenyl-4-yl)naphthalene-2,6-dicarboxamide
-
N2-(3'-(trifluoromethyl)biphenyl-4-yl)naphthalene-2,6-dicarboxamide
-
N2-(3'-methoxybiphenyl-4-yl)naphthalene-2,6-dicarboxamide
-
N2-(3,5-dimethoxyphenyl)naphthalene-2,6-dicarboxamide
-
N2-(3-chlorobiphenyl-4-yl)naphthalene-2,6-dicarboxamide
-
N2-(4-(aminomethyl)phenyl)naphthalene-2,6-dicarboxamide trifluoroacetate
-
N2-phenylnaphthalene-2,6-dicarboxamide
-
naproxen
-
reduces enzyme secretion in chondral and synovial cultures downregulating the PA/plasmin system
PA inhibitor type 1
-
PAI-1, effects of uPA-PAI-1 are abrogated by the nitric-oxide synthase inhibitor N-D-nitro-L-arginine methyl ester. Dramatically elevated levels in case of acute lung injury
-
PD 098059
-
hepatocyte growth factor-mediated uPA secretion by Hep-G2 cells is reduced with increasing concentrations of PD 098059
PD98059
-
the ERK MAP kinase inhibitor dramatically reduces the uPA expression in the frozen-thawed porcine uterus endometrial epithelium cells
PepC
peptide PepC 29[(S21C;H29C)] (CNKYFSNIC)
-
PepL
peptide uPA21-30 (SNKYFSNIHW), PepL does not contain the minimal uPAR-binding region (uPA residues 19-31), but it has the uPA residues Lys23, Tyr24, Phe25, Ile28, and Trp30, which are identified as responsible for uPA-uPAR binding
-
phenethylsulfonamidino-D-seryl-L-alanyl(P2)-L-argininal
-
-
phenethylsulfonamidino-D-seryl-L-alanyl-L-argininal
-
-
phenylmethanesulfonyl fluoride
-
-
plasminogen activator inhibitor
-
PAI-1
-
plasminogen activator inhibitor 1
Plasminogen activator inhibitor 2
-
-
-
plasminogen activator inhibitor type-1
-
plasminogen activator inhibitor-1
plasminogen activator inhibitor-2
-
Plumbagin
-
leads to uPA inhibition and downregulation, inhibits adhesion, migration and invasion in HepG2 cells
Protein C inhibitor
-
-
-
Soybean trypsin inhibitor
-
-
-
staphylokinase
-
competitively inhibits plasminogen activation by endogenous uPA. The N-terminal residues of staphylokinase are important for inhibition
-
thieno[2,3-b]pyridine-2-carboxamidine
-
APC-7538
trans-3,4'-dimethyl-3-hydroxyflavanone
-
i.e. t-flavanone, a synthetic compound with hair growth enhancing activity that is effective against male pattern alopecia, inhibits the enzyme on the surface of keratinocytes, overview
trans-diphenyl N-(N-benzyloxycarbonyl-D-seryl-L-alanyl)amino-(4-(guanylmethyl)-cyclohexyl)methanephosphonate
-
50% inhibition at 0.0011 mM
tripeptidyl diphenyl phosphonates
-
irreversible inhibition
TX-1877
-
hypoxic cell radiosensitizer. Treatment of nude mice bearing subcutaneously or orthotopically implanted human colon cancer cell lines HCT-116 and HT-29 with TX-1877, irradiation or TX-1877 with irradiation results in significant inhibition of matrix metalloproteinase-9 and uPA. Treatments also inhibit the para-aortic lymph node metastasis, however, do not prolong the survival in orthotopic model. In the subcutaneous model, tumors treated with TX-1877 and irradiation show significant reductions in volume
type-1 plasminogen activator inhibitors
-
primary endogenous inhibitors
-
uPAapt-01
DNA aptamer, ATGGTAACATGCACTAGGTCGCGATGGTTCCGTCTGATCGCT
-
uPAapt-02
DNA aptamer, CAAGCGGGGGTGAGAGATCTGTCAGTACGAGCTGGGTTTGCG
-
uPAapt-03
DNA aptamer, ACGGAGGCAGAGGGTGAGAGATCTGTTAGTACTAGCCCATGT
-
uPAapt-06
DNA aptamer, GGGTGGGTGGGTGGGTGATGGCTCGACTCTACCCTGGCGCTG, slight inhibition
-
uPAapt-21
DNA aptamer, GGAGGTACTCACCGACGCTGAACTCCATAGAATGTGGTGATG
-
upain-1
-
competitive, no inhibition of the pro-uPA
WXC-340
-
a selective u-PA inhibitor
[2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]phenyl]acetic acid
-
-
2-([6-[(3'-carbamimidoylbiphenyl-3-yl)oxy]-3,5-difluoro-4-methylpyridin-2-yl]oxy)-4-(dimethylamino)benzoic acid

-
-
2-([6-[(3'-carbamimidoylbiphenyl-3-yl)oxy]-3,5-difluoro-4-methylpyridin-2-yl]oxy)-4-(dimethylamino)benzoic acid
-
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-methylbenzoic acid

-
-
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-methylbenzoic acid
-
2-[(6-[[5-amino-3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-methylbenzoic acid

-
-
2-[(6-[[5-amino-3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-methylbenzoic acid
-
3,5-diamino-N-carbamimidoyl-6-chloropyrazine-2-carboxamide

i.e. amiloride, selectively inhibits the enzyme, but not tissue plasminogen activator or other serine protease members of the trypsin superfamily
3,5-diamino-N-carbamimidoyl-6-chloropyrazine-2-carboxamide
amiloride, inhibits uPA, but shows no or poor inhibition of tPA, plasmin, thrombin, trypsin, plasma kallikrein, FXa, FXla, and activated protein C. The oral K+-sparing diuretic shows anti-cancer side-activities in multiple rodent models. These effects appear to arise, at least in part, through moderate inhibition of the urokinase-type plasminogen activator (uPA). Structure-function relationships analysis. Analysis of cytotoxicity of amiloride, 7, and 15 against a panel of human cell lines, overview
3-(1-carbamimidoylpiperidin-3-yl)-L-alanine

-
-
3-(1-carbamimidoylpiperidin-3-yl)-L-alanine
-
-
3-(1-carbamimidoylpiperidin-4-yl)-L-alanine

-
-
3-(1-carbamimidoylpiperidin-4-yl)-L-alanine
-
-
amiloride

-
competitive, no inhibition of the pro-uPA
amiloride
-
a selective u-PA inhibitor
amiloride
-
significant reduction of hair follicle keratinocyte proliferation
benzamidine

-
-
ecotin

-
inhibits uPA almost 10000-fold less efficiently than trypsin, ecotin is expressed on the surface of filamentous bacteriophage, each of the selected ecotin variants (M84R, M84K, M84R/M85R and M84R/M85K) exhibits increased affinity for uPA when compared to wild-type ecotin, with ecotin M84R/M85R showing 2800-fold increase in binding affinity
-
mupain-1

-
i.e. CPAYSRYLDC, isolated from a murine peptide library and reconstructed, no inhibition of wild-type human enzyme, since the inhibitor is highly specific for the murine enzyme, but inhibition by the human enzyme mutant H99Y, overview, expression of mupain-1 peptide sequence in fusion with the N-terminal domains of the phage coat protein g3p in Escherichia coli
mupain-1
-
i.e. CPAYSRYLDC
mupain-1
-
i.e. CPAYSRYLDC, isolated from a murine peptide library and reconstructed, competitive and highly selective inhibitor, R6 of mupain-1 is the P1 residue, extended binding interaction including the P5, P3, P2, P1, and P1' residues of mupain-1 and the specificity pocket, the catalytic triad, and the amino acids 41, 99 and 192 located in and around the active site of murine uPA, overview, expression of mupain-1 peptide sequence in fusion with the two N-terminal domains of g3p, D1 and D2 in Escherichia coli
mupain-1
-
i.e. CPAYSRYLDC
N-(benzylsulfonyl)-D-seryl-N-(4-carbamimidoylbenzyl)-L-alaninamide

comparison of specificity with five additional trypsin-like serine-proteases
N-(benzylsulfonyl)-D-seryl-N-(4-carbamimidoylbenzyl)-L-alaninamide
-
PAI-1

A0A337S474
plasminogen activator inhibitor
-
PAI-1
-
a proteolytic inhibitor of uPA, blocks the increase in proliferation of myoblasts induced by uPA
-
PAI-2

A0A337S474
plasminogen activator inhibitor
-
PAI-2
-
i.e. plasminogen activator inhibitor type 2, cell-surface enzyme:PAI-2 complex formation is reflective of complete enzyme inhibition, kinetic analysis of inhibition
-
plasminogen activator inhibitor 1

-
human
plasminogen activator inhibitor 1
-
phosphorylated uPA is less sensitive to inhibition than nonphosphorylated uPA
plasminogen activator inhibitor 1
-
-
plasminogen activator inhibitor 1
-
binding of single-chain uPA moiety to the inhibitor occurs with lower affinity compared to binding of the two-chain uPA moiety
plasminogen activator inhibitor 1
-
phosphorylated enzyme is inhibited 50% at a concentration 4fold higher than nonphosphorylated enzyme
plasminogen activator inhibitor 1
-
-
plasminogen activator inhibitor 1
-
PAI-1, complete inhibition, elevated inhibitor specifically inactivates pulmonary urokinase-type plasminogen activator and tissue.type plasminogen activator, EC 3.4.21.68
plasminogen activator inhibitor 1
-
i.e. PAI-1
plasminogen activator inhibitor type-1

-
i.e. PAI type-1, the endogenous inhibitor expression is higher in myometrium than in myoma in the uterus myomatosus, overview
-
plasminogen activator inhibitor type-1
-
i.e. PAI-1, an endogenous inhibitor protein
-
plasminogen activator inhibitor-1

-
-
plasminogen activator inhibitor-1
-
i.e. PAI-1, complexes the enzyme, binding structure, the 10-100-fold higher affinity of the uPA-PAI-1 complex compared with the free components depends on the bonus effect of bringing the binding areas on uPA and PAI-1 together on the same binding entity, overview, inhibitor mutants K71A/R78A/Y81A/K82A, K82A-R120A, and R78A-K124A show reduced binding to the enzyme and the enzyme receptors, effects of several mutations of the inhibitor protein on complex formation and endocytosis, overview
plasminogen activator inhibitor-1
-
-
plasminogen activator inhibitor-1
-
i.e. PAI-1, recombinantly expressed with an N-terminal His6-tag and purified from Escherichia coli cells, labeled with N,N0-dimethyl-N-(iodoacetyl)-N0-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)ethylenediamine, i.e. P9-NBD-labeled PAI-1. Slow formation of a covalent serpin-protease complex between single-chain uPA and PAI-1 is significantly accelerated in the presence of specific dipeptide sequences
plasminogen activator inhibitor-1
-
PAI-1
plasminogen activator inhibitor-1
-
i.e. PAI-1
plasminogen activator inhibitor-1
-
PAI-1
plasminogen activator inhibitor-1
PAI-1, specifically and rapidly inhibits urokinase-type plasminogen activator uPA and tissue-type plasminogen activator, tPA, EC 3.4.21.68. The PAI-1 reactive center loop serves as a bait to attract uPA onto the top of the PAI-1 molecule. P4P3' residues of the reactive center loop interact extensively with the uPA catalytic site, accounting for about two-thirds of the total contact area, also almost all uPA exosite loops, including the 37-, 60-, 97-, 147-, and 217-loops, are involved in the interaction with PAI-1, of the residues of the 37-loop, Arg-E37a plays the most important role, Michaelis complex formation, overview. The recombinant stable His-tagged PAI-1 mutant 14-1B containing four point mutations N150H, K154T, Q319L, and M354I, is expressed in Escherichia coli strain C41(DE3) using the expression vector pT7-PL
plasminogen activator inhibitor-1
PAI-1, inhibitor and uPA form a covalently linked complex, which is absorbed together with receptor uPAR through endocytosis leading to degradation of the uPA-PAI-1 complex and releases free uPAR to the extracellular region
plasminogen activator inhibitor-1
-
an endogenous inhibitor protein, i.e. PAI-1
plasminogen activator inhibitor-2

-
PAI-2
-
plasminogen activator inhibitor-2
-
i.e. PAI-2
-
plasminogen activator inhibitor-2
-
PAI-2
-
additional information

-
humanized murine ATF, i.e. an amino-terminal fragment of urokinase, represses 79% of membrane-associated enzyme activity on MDA-MB-231 cells, murine ATF represses 29% of activity
-
additional information
-
development of potent uncharged inhibitors of uPA based upon the isocoumarin scaffold, bromine occupies the same position as positively charged arginino mimetic groups, structure activity relationships, inhibitor synthesis and molecular modeling, overview
-
additional information
-
the active form of uPA is bound to its high affinity receptor on the cell surface, where specific inhibitors modulate its enzymatic activity, such inhibitors also regulate the cell surface levels of uPA by triggering the internalization of the uPA-receptor-inhibitor complex via endocytosis
-
additional information
-
quantitative structure-activity relationship analysis of substituted 2-pyridinyl guanidines as selective inhibitors using QuaSAR descriptors of molecular modeling software MOE. uPA inhibitory activity of core-substitued 2-pyridinyl guanidines is influenced by their molecular shape, molecular flexibility and halogen atoms in the molecule. uPA inhibitory activity of 2-(5-chloropyridin-2-yl) guanidines with bulky substituents in position 3 is dependent on molecular lipophilicity, number of double bonds and spatial orientation of bulky substituents in the molecule
-
additional information
-
stable expression of dominant-negative MEK-1 in Hep-G2 cells decreases S hepatocyte growth factor-mediated uPA secretion
-
additional information
-
identification of potent, selective, and orally bioavailable non-amidine uPA inhibitors, binding in the S1 pocket, overview
-
additional information
-
Thrombin hydrolysis provides the mechanism of proteolytic inactivation of uPA cleavage of the Arg156-Phe157 enzyme bond that does not exclude nonproteolytic functioning of such peptide forms
-
additional information
-
synthesis of peptides competing with uPA for binding to the specific uPA receptor, usage of the SAAC methodology to regioselectively label the peptides, overview
-
additional information
-
the autolysis loop in the catalytic domain of uPA is a potential inhibitory target. Three antibodies are potent inhibitors of uPA activity, two pro-uPA-specific ones by inhibiting conversion of pro-uPA to active uPA and an active uPA-specific antibody by shielding the access of plasminogen to the active site, overview. The conformation-specific antibodies mAb-112 and mAb-12E6B10 are useful to selectively stain pro-uPA or active uPA on the surface of cultured cells. Antibody mAb-112 is a non-competitive inhibitor of S-2444 cleavage by uPA with a Ki similar to the Kd for mAb-112 binding to active two-chain uPA. The epitopes of the conformation-specific antibodies are all localized to the activation and/or autolysis loop, binding kinetic analysis and models of the three-dimensional structures, overview
-
additional information
-
efficacy of grape seed extract in negatively regulating uPA expression and cell migration using highly metastatic androgen-independent PC3 prostate cancer cells as a model. Grape seed extract inhibits and downregulates NFkB-dependent urokinase plasminogen activator promoter activity
-
additional information
-
no inhibition by LY294002 and AktI
-
additional information
-
synthesis and inhibitory potencies of d-Ser-Ala-Arg-NH-X peptides, overview. All compounds with a hydroxyl residue of an amide group do not inhibit urokinase, no inhibition by D-Ser-Ala-Arg-NH
-
additional information
2-amidino analogues of glycine-amiloride conjugates as inhibitors of urokinase-type plasminogen activator, design and synthesis, overview. Substitution of C2-acylguanidine of C5-glycyl-amiloride with amidine and amidoxime groups, respectively. Importance of maintaining C5-hydrophobicity
-
additional information
-
2-amidino analogues of glycine-amiloride conjugates as inhibitors of urokinase-type plasminogen activator, design and synthesis, overview. Substitution of C2-acylguanidine of C5-glycyl-amiloride with amidine and amidoxime groups, respectively. Importance of maintaining C5-hydrophobicity
-
additional information
synthesis and evaluation of a series of naphthamide and naphthalene sulfonamides as enzyme inhibitors containing non-basic groups as substitute for amidine or guanidine groups, overview
-
additional information
enzyme inhibitor screening, genetic algorithm-based quantitative structure-activity relationship analysis to select the best possible combination of pharmacophoric models and physicochemical descriptors that can explain bioactivity variation within the training inhibitors, overview. At least three binding modes are accessible to ligands within the enzyme binding pocket
-
additional information
extracts of tropical plants show enzyme inhibition activity, e.g. extracts from Croton lucidus, Erythroxylum aerolatum, Tabebuia heterophylla, Lantana camara, Cananga odorata, and Amyris elemifera. Extracts from leaves of Croton lucidus, a small shrub in the Euphorbiaceae family, typically growing in the limestone hills, coastal forests in the subtropical dry forest life zone in southwestern Puerto Rico, show presence of a strong enzyme inhibitory activity, comparison of extract from petroleum ether, chloroform, ethyl acetate and n-butanol, overview. The chloroform extract shows the highest inhibitory potency with 74% inhibition and an IC50 value of 0.00352 mg/ml. Analysis of the cytostatic activity of the extracts on PaCa-2 cells, highest cytotxic effct by choroform, lowest by n-butanol extract
-
additional information
-
extracts of tropical plants show enzyme inhibition activity, e.g. extracts from Croton lucidus, Erythroxylum aerolatum, Tabebuia heterophylla, Lantana camara, Cananga odorata, and Amyris elemifera. Extracts from leaves of Croton lucidus, a small shrub in the Euphorbiaceae family, typically growing in the limestone hills, coastal forests in the subtropical dry forest life zone in southwestern Puerto Rico, show presence of a strong enzyme inhibitory activity, comparison of extract from petroleum ether, chloroform, ethyl acetate and n-butanol, overview. The chloroform extract shows the highest inhibitory potency with 74% inhibition and an IC50 value of 0.00352 mg/ml. Analysis of the cytostatic activity of the extracts on PaCa-2 cells, highest cytotxic effct by choroform, lowest by n-butanol extract
-
additional information
although the interaction areas between protease-substrate and protease-inhibitor are shared, the two interactions are mechanistically different. Species specificity of the reaction of PAI-1 and uPA. Analysis of interaction kinetics of the wild-type and mutant human enzymes with human and zebrafish plasminogen activator inhibitor-1 and of the zebrafish wild-type and mutant enzyme with both inhibitors, overview
-
additional information
-
although the interaction areas between protease-substrate and protease-inhibitor are shared, the two interactions are mechanistically different. Species specificity of the reaction of PAI-1 and uPA. Analysis of interaction kinetics of the wild-type and mutant human enzymes with human and zebrafish plasminogen activator inhibitor-1 and of the zebrafish wild-type and mutant enzyme with both inhibitors, overview
-
additional information
6-substituted amiloride derivatives are inhibitors of the urokinase-type plasminogen activator for use in metastatic disease. Applying the selective optimization of side-activity (SOSA) approach and preparation of a focused library of twenty two 6-substituted amiloride derivatives. The potency increases relative to amiloride arise from increased occupancy of uPA's S1beta subsite by the appended 6-substituents
-
additional information
development of of ligands by exponential enrichment (SELEX) and selection of single stranded DNA aptamers targeting different forms of human uPA. Selected aptamers allow the distinction between high molecular weight (HMW)-uPA and low molecular weight (LMW)-uPA, and probably havine different binding regions, no cross-reactivity to mouse uPA or tissue-type plasminogen activator (tPA) is measured, demonstrating high specificity. RNA aptamers are known to inhibit uPA-uPAR binding
-
additional information
-
humanized murine ATF, i.e. an amino-terminal fragment of urokinase, represses 29% of membrane-associated enzyme activity on LLC cells, murine ATF represses 74% of activity
-
additional information
-
phage-displayed peptide library screening for murine uPA-binding peptide sequences, overview
-
additional information
cyclization improves the stability of mimetic peptides without compromising their binding energies to uPAR. Peptide H1 (Gly-Lys-Gly-Glu-Gly-Glu-Gly-Lys-Gly) is unable to block the uPA-uPAR interaction. PepL binds more strongly to uPAR than PepC essentially due to the significant interaction between uPAR and Trp30, which is present in the PepL structure only
-
additional information
-
the MAP kinase inhibitors SP600125, a JNK inhibitor, and SB203580, a p38 inhibitor, do not inhibit uPA in frozen-thawed porcine uterus endometrial epithelium cells
-
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
0.0039
2-(1-hydroxynaphthalen-2-yl)-1-H-benzoimidazole-5-carboxamidine
-
pH 7.4, 37°C
0.0019
2-(2,6-dihydroxyphenyl)-1-H-benzoimidazole-5-carboxamidine
-
pH 7.4, 37°C
0.00028
2-(2-hydroxy-3-bromo-5-methylphenyl)-1-H-benzoimidazole-5-carboxamidine
-
pH 7.4, 37°C
0.00025
2-(2-hydroxy-3-bromophenyl)-1-H-benzoimidazole-5-carboxamidine
-
pH 7.4, 37°C
0.00055
2-(2-hydroxy-3-fluorophenyl)-1-H-benzoimidazole-5-carboxamidine
-
pH 7.4, 37°C
0.0036
2-(2-hydroxy-3-methoxyphenyl)-1-H-benzoimidazole-5-carboxamidine
-
pH 7.4, 37°C
0.008
2-(2-hydroxy-3-methylphenyl)-1-H-benzoimidazole-5-carboxamidine
-
pH 7.4, 37°C
0.0009
2-(2-hydroxy-3-nitrophenyl)-1-H-benzoimidazole-5-carboxamidine
-
pH 7.4, 37°C
0.013
2-(2-hydroxy-4-diethylaminophenyl)-1-H-benzoimidazole-5-carboxamidine
-
pH 7.4, 37°C
0.0036
2-(2-hydroxy-4-methylphenyl)-1-H-benzoimidazole-5-carboxamidine
-
pH 7.4, 37°C
0.0037
2-(2-hydroxy-5-bromophenyl)-1-H-benzoimidazole-5-carboxamidine
-
pH 7.4, 37°C
0.0005
2-(2-hydroxy-5-chlorobiphenyl-3-yl)-1-H-benzoimidazole-5-carboxamidine
-
pH 7.4, 37°C
0.0028
2-(2-hydroxy-5-fluorophenyl)-1-H-benzoimidazole-5-carboxamidine
-
pH 7.4, 37°C
0.0036
2-(2-hydroxy-5-methoxyphenyl)-1-H-benzoimidazole-5-carboxamidine
-
pH 7.4, 37°C
0.0075
2-(2-hydroxy-5-methylphenyl)-1-H-benzoimidazole-5-carboxamidine
-
pH 7.4, 37°C
0.0033
2-(2-hydroxy-5-nitrophenyl)-1-H-benzoimidazole-5-carboxamidine
-
pH 7.4, 37°C
0.0004
2-(2-hydroxybiphenyl-3-yl)-1-H-benzoimidazole-5-carboxamidine
-
pH 7.4, 37°C
0.0055
2-(2-hydroxyphenyl)-1-H-benzoimidazole-5-carboxamidine
-
pH 7.4, 37°C
0.00018
2-(4-chloro-7-(2-cyano-6-methoxyphenyl)isoquinolin-1-yl)guanidine
-
-
0.0001
2-(4-chloro-7-(2-methoxyphenyl)isoquinolin-1-yl)guanidine
-
-
0.000083
2-(4-chloro-7-(3-methoxyphenyl)isoquinolin-1-yl)guanidine
-
-
0.0001
2-(7-(1,3-benzodioxol-5-yl)-4-chloroisoquinolin-1-yl)guanidine
-
-
0.00034
2-(7-(1,3-benzodioxol-5-yl)isoquinolin-1-yl)guanidine
-
-
0.0004
2-(7-phenylisoquinolin-1-yl)guanidine
-
-
0.055
2-phenyl-1-H-benzoimidazole-5-carboxamidine
-
pH 7.4, 37°C
0.00002
2-[2-(7-amino-4-chloro-1-oxo-1H-isochromen-3-yloxy)ethyl]isothiourea hydrobromide
-
pH 8.8, 25°C
0.000084
2-[2-(7-benzamido-4-chloro-1-oxo-1H-isochromen-3-yloxy)ethyl]isothiourea hydrobromide
-
pH 8.8, 25°C
0.000038
2-[3-(7-amino-4-chloro-1-oxo-1H-isochromen-3-yloxy)propyl]isothiourea hydrobromide
-
pH 8.8, 25°C
0.00001
2-[3-(7-benzamido-4-chloro-1-oxo-1H-isochromen-3-yloxy]propyl)isothiourea hydrobromide
-
pH 8.8, 25°C
0.000302
3,5-diamino-6-(1-benzofuran-2-yl)-N-carbamimidoylpyrazine-2-carboxamide
pH and temperature not specified in the publication
0.00035
3,5-diamino-6-(1-benzofuran-5-yl)-N-carbamimidoylpyrazine-2-carboxamide
pH and temperature not specified in the publication
0.001414
3,5-diamino-6-(1-benzothiophen-2-yl)-N-carbamimidoylpyrazine-2-carboxamide
pH and temperature not specified in the publication
0.003645
3,5-diamino-6-(5-bromo-1-benzofuran-2-yl)-N-carbamimidoylpyrazine-2-carboxamide
pH and temperature not specified in the publication
0.000482
3,5-diamino-N-carbamimidoyl-6-(1-methyl-1H-pyrazol-4-yl)pyrazine-2-carboxamide
pH and temperature not specified in the publication
0.001477
3,5-diamino-N-carbamimidoyl-6-(2,3-dihydro-1-benzofuran-5-yl)pyrazine-2-carboxamide
pH and temperature not specified in the publication
0.001626
3,5-diamino-N-carbamimidoyl-6-(2,4-dimethoxypyrimidin-5-yl)pyrazine-2-carboxamide
pH and temperature not specified in the publication
0.001208
3,5-diamino-N-carbamimidoyl-6-(2,6-dimethoxypyridin-3-yl)pyrazine-2-carboxamide
pH and temperature not specified in the publication
0.000204
3,5-diamino-N-carbamimidoyl-6-(2-methoxypyrimidin-5-yl)pyrazine-2-carboxamide
pH and temperature not specified in the publication
0.000578
3,5-diamino-N-carbamimidoyl-6-(5-chloro-1-benzofuran-2-yl)pyrazine-2-carboxamide
pH and temperature not specified in the publication
0.000904
3,5-diamino-N-carbamimidoyl-6-(5-cyano-1-benzofuran-2-yl)pyrazine-2-carboxamide
pH and temperature not specified in the publication
0.000587
3,5-diamino-N-carbamimidoyl-6-(5-fluoro-1-benzofuran-2-yl)pyrazine-2-carboxamide
pH and temperature not specified in the publication
0.000287
3,5-diamino-N-carbamimidoyl-6-(5-methoxy-1-benzofuran-2-yl)pyrazine-2-carboxamide
pH and temperature not specified in the publication
0.000642
3,5-diamino-N-carbamimidoyl-6-(5-methyl-1-benzofuran-2-yl)pyrazine-2-carboxamide
pH and temperature not specified in the publication
0.000439
3,5-diamino-N-carbamimidoyl-6-(6-methoxy-1-benzofuran-2-yl)pyrazine-2-carboxamide
pH and temperature not specified in the publication
0.000776
3,5-diamino-N-carbamimidoyl-6-(furan-2-yl)pyrazine-2-carboxamide
pH and temperature not specified in the publication
0.000499
3,5-diamino-N-carbamimidoyl-6-(furan-3-yl)pyrazine-2-carboxamide
pH and temperature not specified in the publication
0.000771
3,5-diamino-N-carbamimidoyl-6-(pyrimidin-5-yl)pyrazine-2-carboxamide
pH and temperature not specified in the publication
0.001259
3,5-diamino-N-carbamimidoyl-6-(thiophen-2-yl)pyrazine-2-carboxamide
pH and temperature not specified in the publication
0.002433
3,5-diamino-N-carbamimidoyl-6-chloropyrazine-2-carboxamide
pH and temperature not specified in the publication
0.002498
3,5-diamino-N-carbamimidoyl-6-phenylpyrazine-2-carboxamide
pH and temperature not specified in the publication
0.002409
3,5-diamino-N-carbamimidoyl-6-[4-(methylsulfanyl)phenyl]pyrazine-2-carboxamide
pH and temperature not specified in the publication
0.003136
3,5-diamino-N-carbamimidoyl-6-[4-(trifluoromethyl)phenyl]pyrazine-2-carboxamide
pH and temperature not specified in the publication
0.0065 - 0.219
3-(1-carbamimidoylpiperidin-3-yl)-L-alanine
0.00248 - 0.045
3-(1-carbamimidoylpiperidin-4-yl)-L-alanine
0.0042
3-(2-bromoethoxy)-7-nitro-1H-isochromen-1-one
-
pH 8.8, 25°C
0.014
3-(3-bromopropoxy)-4-trifluoroacetyl-1H-isochromen-1-one
-
pH 8.8, 25°C
0.0043
3-(3-bromopropoxy)-7-nitro-1H-isochromen-1-one
-
pH 8.8, 25°C
0.000009
3-(4-chloro-1-((diaminomethylene)amino)isoquinolin-7-yl)-5-methoxybenzoic acid
-
-
0.000037
3-(4-chloro-1-((diaminomethylene)amino)isoquinolin-7-yl)benzoic acid
-
-
0.000082
4-(4-chloro-1-((diaminomethylene)amino)isoquinolin-7-yl)benzoic acid
-
-
0.0395
4-aminobenzamidine
-
pH 7.4, 37°C, mature uPA
0.00021
4-iodobenzo[b]thiophene-2-carboxamidine
-
pH 7.4, 37°C
0.000139
6-carbamimidoyl-N-(3,5-dimethoxyphenyl)-2-naphthamide
pH 8.8, 37°C
0.000631
6-carbamimidoyl-N-phenyl-2-naphthamide
pH 8.8, 37°C
0.065
7-amino-3-(2-bromoethoxy)-1H-isochromen-1-one
-
pH 8.8, 25°C
0.00063
7-methoxy-8-[1-(methylsulfonyl)-1H-pyrazol-4-yl]naphthalene-2-carboximidamide
pH 7.4, 37°C
0.005
amiloride
-
pH 7.4, 37°C, mature uPA
0.097
benzamidine
-
pH 7.4, 37°C
0.0023
benzo[b]thiophene-2-carboxamidine
-
pH 7.4, 37°C
0.0063
D-Ser-Ala-Arg-NH-(CH2)5-NH2
-
pH 8.8, 37°C
0.00041
ethyl 4-(3-carbamimidoyl-N-[[2,4,6-tri(propan-2-yl)phenyl]sulfonyl]-L-phenylalanyl)piperazine-1-carboxylate
pH 8.8, 37°C
0.00004
N-(4-(aminomethyl)phenyl)-6-carbamimidoyl-2-naphthamide trifluoro acetate
pH 8.8, 37°C
0.0000077 - 0.0077
N-(benzylsulfonyl)-D-seryl-N-(4-carbamimidoylbenzyl)-L-alaninamide
0.013
N-(benzylsulfonyl)-D-seryl-N-(4-carbamimidoylbenzyl)-L-prolinamide
-
0.02
N-(benzylsulfonyl)-D-seryl-N-(4-carbamimidoylbenzyl)-L-serinamide
-
0.036
N-(benzylsulfonyl)-D-seryl-N-(4-carbamimidoylbenzyl)glycinamide
-
0.018
N-[(4-aminobenzyl)sulfonyl]-D-seryl-N-(4-carbamimidoylbenzyl)glycinamide
-
0.0076
N-[(4-chlorobenzyl)sulfonyl]-D-seryl-N-(4-carbamimidoylbenzyl)-L-alaninamide
-
0.023
N-[(4-chlorobenzyl)sulfonyl]-D-seryl-N-(4-carbamimidoylbenzyl)-L-serinamide
-
0.01
N-[(4-methylbenzyl)sulfonyl]-D-seryl-N-(4-carbamimidoylbenzyl)-L-alaninamide
-
0.024
N-[(4-nitrobenzyl)sulfonyl]-D-seryl-N-(4-carbamimidoylbenzyl)glycinamide
-
0.0014
N-[3-(2-bromoethoxy)-4-chloro-1-oxo-1H-isochromen-7-yl]benzamide
-
pH 8.8, 25°C
0.000034
N-[3-(3-bromopropoxy)-4-chloro-1-oxo-1H-isochromen-7-yl]benzamide
-
pH 8.8, 25°C
0.0000006
N-[4-(aminomethyl)phenyl]-6-carbamimidoyl-4-(pyrimidin-2-ylamino)naphthalene-2-carboxamide
pH 7.4, 37°C
0.018
N-[[4-(methoxycarbonyl)benzyl]sulfonyl]-D-seryl-N-(4-carbamimidoylbenzyl)-L-alaninamide
-
0.000002 - 0.000028
phenethylsulfonamidino-D-seryl-L-alanyl(P2)-L-argininal
0.063
thieno[2,3-b]pyridine-2-carboxamidine
-
pH 7.4, 37°C
0.0022
upain-1
-
pH 7.4, 37°C, mature uPA
additional information
additional information
-
0.0065
3-(1-carbamimidoylpiperidin-3-yl)-L-alanine

-
pH 7.4, 37°C, wild-type enzyme
0.219
3-(1-carbamimidoylpiperidin-3-yl)-L-alanine
-
pH 7.4, 37°C, enzyme mutant H99Y
0.00248
3-(1-carbamimidoylpiperidin-4-yl)-L-alanine

-
pH 7.4, 37°C, enzyme mutant H99Y
0.045
3-(1-carbamimidoylpiperidin-4-yl)-L-alanine
-
pH 7.4, 37°C, wild-type enzyme
0.0004
mupain-1

-
pH 7.4, 37°C
0.0036
mupain-1
-
pH 7.4, 37°C, mutant V41K/H99Y/Q192K
0.0069
mupain-1
-
pH 7.4, 37°C, mutant V41K/H99Y
0.0153
mupain-1
-
pH 7.4, 37°C, mutant H99Y
0.0000077
N-(benzylsulfonyl)-D-seryl-N-(4-carbamimidoylbenzyl)-L-alaninamide

pH 8.8, 37°C
0.0077
N-(benzylsulfonyl)-D-seryl-N-(4-carbamimidoylbenzyl)-L-alaninamide
-
0.000002
phenethylsulfonamidino-D-seryl-L-alanyl(P2)-L-argininal

-
pH 7.4, 37°C, compound uPA-I5
0.000003
phenethylsulfonamidino-D-seryl-L-alanyl(P2)-L-argininal
-
pH 7.4, 37°C, compound uPA-I6
0.000006
phenethylsulfonamidino-D-seryl-L-alanyl(P2)-L-argininal
-
pH 7.4, 37°C, compound uPA-I3
0.000014
phenethylsulfonamidino-D-seryl-L-alanyl(P2)-L-argininal
-
pH 7.4, 37°C, compound uPA-I4
0.000021
phenethylsulfonamidino-D-seryl-L-alanyl(P2)-L-argininal
-
pH 7.4, 37°C, compound uPA-I1
0.000028
phenethylsulfonamidino-D-seryl-L-alanyl(P2)-L-argininal
-
pH 7.4, 37°C, compound uPA-I2
additional information
additional information

-
inhibition kinetics
-
additional information
additional information
-
inhibition kinetics
-
additional information
additional information
-
kinetic effects of dipeptides on the inhibition of single-chain uPA and two-chain uPA, overview. Stopped-flow kinetics of P9-NBD-labeled PAI-1, 25°C, overview
-
additional information
additional information
-
inhibition kinetics of mupain variants, overview
-
additional information
additional information
-
inhibition kinetics of mupain variants, overview
-
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
0.0000035
1-[(N-benzylsulfonyl-D-seryl)-L-alanyl]amino-2-(4-guanidinophenyl)ethanephosphonate trifluoroacetate
Mus musculus
-
pH 8.8, 37°C
0.013
1-[3'-([3,5-difluoro-6-[5-methyl-2-(1H-tetrazol-1-yl)phenoxy]pyridin-2-yl]oxy)biphenyl-3-yl]methanamine
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.000098
2-([6-[(3'-carbamimidoylbiphenyl-3-yl)oxy]-3,5-difluoro-4-methylpyridin-2-yl]oxy)-4-(dimethylamino)benzoic acid
0.0027
2-[(6-[[3',5-bis(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-methylbenzoic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.000023
2-[(6-[[3'-(aminomethyl)-5-hydroxybiphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-methylbenzoic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.00054
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-3-methylbenzoic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.00068
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-(propan-2-yl)benzoic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.00022
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-methoxybenzoic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.00024
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-methylbenzoic acid
0.0013
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-nitrobenzoic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.0035
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-5-methylbenzoic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.026
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-6-methylbenzoic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.00084
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]benzoic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.000025
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-4-[3-(dimethylamino)pyrrolidin-1-yl]-3,5-difluoropyridin-2-yl)oxy]-4-(dimethylamino)benzoic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.0001
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-4-[[2-(dimethylamino)ethyl](methyl)amino]-3,5-difluoropyridin-2-yl)oxy]-4-(dimethylamino)benzoic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.03
2-[(6-[[4'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-(dimethylamino)benzoic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.000089
2-[(6-[[4-amino-3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-methylbenzoic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.000039
2-[(6-[[5-amino-3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-methylbenzoic acid
0.000015
2-[(6-[[5-amino-3'-(aminomethyl)biphenyl-3-yl]oxy]-4-[3-(dimethylamino)pyrrolidin-1-yl]-3,5-difluoropyridin-2-yl)oxy]-4-methylbenzoic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.03
2-[(6-[[6-amino-3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-methylbenzoic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.03
2-[[3,5-difluoro-6-([3'-[(methylamino)methyl]biphenyl-3-yl]oxy)pyridin-2-yl]oxy]-4-(dimethylamino)benzoic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.00013
2-[[6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoro-4-(methylamino)pyridin-2-yl]oxy]-4-(dimethylamino)benzoic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.0009
2-[[6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoro-4-(morpholin-4-yl)pyridin-2-yl]oxy]-4-(dimethylamino)benzoic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.000065
2-[[6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoro-4-(piperazin-1-yl)pyridin-2-yl]oxy]-4-(dimethylamino)benzoic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.00053
2-[[6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-4-(dimethylamino)-3,5-difluoropyridin-2-yl]oxy]-4-(dimethylamino)benzoic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.02
3-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]benzoic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.03
3-[2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]phenyl]propanoic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.000072
4-(2-aminoethoxy)-N-(3-chloro-2-ethoxy-5-piperidin-1-ylphenyl)-3,5-dimethylbenzamide
Rattus norvegicus
-
-
0.000072
4-(2-aminoethoxy)-N-[3-chloro-2-ethoxy-5-(piperidin-1-yl)phenyl]-3,5-dimethylbenzamide
Homo sapiens
pH 8.8, 37°C
0.03
4-(dimethylamino)-2-[[6-([3'-[(dimethylamino)methyl]biphenyl-3-yl]oxy)-3,5-difluoropyridin-2-yl]oxy]benzoic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.03
4-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]benzoic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.0002
4-[(E)-(5-oxo-2-phenyl-1,3-oxazol-4(5H)-ylidene)methyl]benzenecarboximidamide
Homo sapiens
pH 8.8, 37°C
0.0026
6-carbamimidoyl-N-(3,5-dimethoxyphenyl)-2-naphthamide
Homo sapiens
pH 8.8, 37°C
0.013
6-carbamimidoyl-N-phenyl-2-naphthamide
Homo sapiens
pH 8.8, 37°C
0.02
6-cyano-N-(3'-methoxybiphenyl-4-yl)-2-naphthamide
Homo sapiens
pH 8.8, 37°C
0.0021
6-methoxy-N-(3'-(trifluoromethyl)biphenyl-4-yl)-2-naphthamide
Homo sapiens
pH 8.8, 37°C
0.0041
6-methoxy-N-(3'-(trifluoromethyl)biphenyl-4-yl)naphthalene-2-sulfonamide
Homo sapiens
pH 8.8, 37°C
0.004
6-methoxy-N-(3'-methoxybiphenyl-4-yl)-2-naphthamide
Homo sapiens
pH 8.8, 37°C
0.019
6-methoxy-N-(3'-methoxybiphenyl-4-yl)naphthalene-2-sulfonamide
Homo sapiens
pH 8.8, 37°C
0.0026
6-methoxy-N-(3'-nitrobiphenyl-4-yl)-2-naphthamide
Homo sapiens
pH 8.8, 37°C
0.0069
6-methoxy-N-(3'-nitrobiphenyl-4-yl)naphthalene-2-sulfonamide
Homo sapiens
pH 8.8, 37°C
0.012
6-methoxy-N-(4'-methoxybiphenyl-4-yl)-2-naphthamide
Homo sapiens
pH 8.8, 37°C
0.023
6-methoxy-N-(4'-methoxybiphenyl-4-yl)naphthalene-2-sulfonamide
Homo sapiens
pH 8.8, 37°C
0.0123
amiloride
Homo sapiens
pH 7.4, 37°C
0.0000089
antibody IgG(DS2)
Homo sapiens
-
pH 7.4, 22°C
-
0.0000067
antibody scFv(DS2)
Homo sapiens
-
pH 7.4, 22°C
-
0.0000034
bis[(phenylamino)acetyl] [2-(4-carbamimidamidophenyl)-1-[(methoxycarbonyl)amino]ethyl]phosphonate
Homo sapiens
pH 8.8, 37°C
0.0000067
di-(4-acetamidophenyl) 1-[(N-benzyloxycarbonyl-D-seryl)-Lalanyl]amino-2-[4-(guanidino)phenyl]-ethanephosphonate trifluoroacetate
Mus musculus
-
pH 8.8, 37°C
0.000008
diphenyl 1-[(N-2-acetoadamantanyl-D-seryl)-L-alanyl]amino-2-(4-guanidinophenyl)ethanephosphonate trifluoroacetate
Mus musculus
-
pH 8.8, 37°C
0.0000069
diphenyl 1-[(N-2-acetothiophenyl-D-seryl)-L-alanyl]amino-2-(4-guanidinophenyl)ethanephosphonate trifluoroacetate
Mus musculus
-
pH 8.8, 37°C
0.0000026
diphenyl 1-[(N-benzenesulfonyl-D-seryl)-L-alanyl]amino-2-(4-guanidinophenyl)ethanephosphonate trifluoroacetate
Mus musculus
-
pH 8.8, 37°C
0.0000043
diphenyl 1-[(N-benzoyloxycarbonyl-D-seryl)-L-alanyl]amino-2-(4-guanidinophenyl)ethanephosphonate trifluoroacetate
Mus musculus
-
pH 8.8, 37°C
0.000005
diphenyl 1-[(N-benzoylsulfonyl-D-seryl)-L-alanyl]amino-2-(4-guanidinophenyl)ethanephosphonate trifluoroacetate
Mus musculus
-
pH 8.8, 37°C
0.0000058
diphenyl 1-[(N-naphthalenesulfonyl-D-seryl)-L-alanyl]amino-2-(4-guanidinophenyl)ethanephosphonate trifluoroacetate
Mus musculus
-
pH 8.8, 37°C
0.000006
diphenyl 1-[(N-o,o-dimethylbenzoyl-D-seryl)-L-alanyl]amino-2-(4-guanidinophenyl)ethanephosphonate trifluoroacetate
Mus musculus
-
pH 8.8, 37°C
0.0000044
diphenyl 1-[(N-o-methylbenzoyl-D-seryl)-L-alanyl]amino-2-(4-guanidinophenyl)ethanephosphonate trifluoroacetate
Mus musculus
-
pH 8.8, 37°C
0.0000066
diphenyl 1-[(N-p-bromobenzenesulfonyl-D-seryl)-L-alanyl]-amino-2-(4-guanidinophenyl)ethane-phosphonate trifluoroacetate
Mus musculus
-
pH 8.8, 37°C
0.0000062
diphenyl 1-[(N-p-cyanobenzenesulfonyl-D-seryl)-L-alanyl]-amino-2-(4-guanidinophenyl)ethane-phosphonate trifluoroacetate
Mus musculus
-
pH 8.8, 37°C
0.0000058
diphenyl 1-[(N-p-methoxybenzenesulfonyl-D-seryl)-L-alanyl]-amino-2-(4-guanidinophenyl)ethane-phosphonate trifluoroacetate
Mus musculus
-
pH 8.8, 37°C
0.000007
diphenyl 1-[(N-p-methylbenzoyl-D-seryl)-L-alanyl]amino-2-(4-guanidinophenyl)ethanephosphonate trifluoroacetate
Mus musculus
-
pH 8.8, 37°C
0.0000015
diphenyl 1-[(N2-thiophenesulfonyl-D-seryl)-L-alanyl]amino-2-(4-guanidinophenyl)ethanephosphonate trifluoroacetate
Mus musculus
-
pH 8.8, 37°C
0.0000031
diphenyl [2-(4-carbamimidamidophenyl)-1-[(methoxycarbonyl)amino]ethyl]phosphonate
Homo sapiens
pH 8.8, 37°C
0.016
methyl 4'-(2-naphthamido)biphenyl-3-carboxylate
Homo sapiens
pH 8.8, 37°C
0.031
methyl 4'-(6-amino-2-naphthamido)biphenyl-3-carboxylate
Homo sapiens
pH 8.8, 37°C
0.011
methyl 4'-(6-bromo-2-naphthamido)biphenyl-3-carboxylate
Homo sapiens
pH 8.8, 37°C
0.0036
methyl 4'-(6-carbamoyl-2-naphthamido)biphenyl-3-carboxylate
Homo sapiens
pH 8.8, 37°C
0.007
methyl 4'-(6-chloro-2-naphthamido)biphenyl-3-carboxylate
Homo sapiens
pH 8.8, 37°C
0.009
methyl 4'-(6-cyano-2-naphthamido)biphenyl-3-carboxylate
Homo sapiens
pH 8.8, 37°C
0.004
methyl 4'-(6-methoxy-2-naphthamido)biphenyl-3-carboxylate
Homo sapiens
pH 8.8, 37°C
0.0028
methyl 4'-(6-methoxynaphthalene-2-sulfonamido)biphenyl-3-carboxylate
Homo sapiens
pH 8.8, 37°C
0.016
methyl 4'-(6-methoxynaphthalene-2-sulfonamido)biphenyl-4-carboxylate
Homo sapiens
pH 8.8, 37°C
0.016
methyl 4'-(naphthalene-2-sulfonamido)biphenyl-3-carboxylate
Homo sapiens
pH 8.8, 37°C
0.0098
methyl 4'-(naphthalene-2-sulfonamido)biphenyl-4-carboxylate
Homo sapiens
pH 8.8, 37°C
0.014
methyl 6-(3'-(methoxycarbonyl)biphenyl-4-ylcarbamoyl)-2-naphthoate
Homo sapiens
pH 8.8, 37°C
0.008
N-(2,4'-dimethoxybiphenyl-4-yl)-6-methoxynaphthalene-2-sulfonamide
Homo sapiens
pH 8.8, 37°C
0.031
N-(3',4'-dimethoxybiphenyl-4-yl)-6-methoxy-2-naphthamide
Homo sapiens
pH 8.8, 37°C
0.008
N-(3',4'-dimethoxybiphenyl-4-yl)-6-methoxynaphthalene-2-sulfonamide
Homo sapiens
pH 8.8, 37°C
0.062
N-(3'-aminobiphenyl-4-yl)-6-methoxynaphthalene-2-sulfonamide
Homo sapiens
pH 8.8, 37°C
0.0098
N-(3'-methoxybiphenyl-4-yl)-2-naphthamide
Homo sapiens
pH 8.8, 37°C
0.031
N-(3'-methoxybiphenyl-4-yl)naphthalene-2-sulfonamide
Homo sapiens
pH 8.8, 37°C
0.0012
N-(4-(aminomethyl)phenyl)-6-carbamimidoyl-2-naphthamide trifluoro acetate
Homo sapiens
pH 8.8, 37°C
0.031
N-(biphenyl-4-yl)-6-methoxynaphthalene-2-sulfonamide
Homo sapiens
pH 8.8, 37°C
0.0064
N2-(2,4'-dimethoxybiphenyl-4-yl)naphthalene-2,6-dicarboxamide
Homo sapiens
pH 8.8, 37°C
0.0024
N2-(3'-(trifluoromethyl)biphenyl-4-yl)naphthalene-2,6-dicarboxamide
Homo sapiens
pH 8.8, 37°C
0.0029
N2-(3'-methoxybiphenyl-4-yl)naphthalene-2,6-dicarboxamide
Homo sapiens
pH 8.8, 37°C
0.03
N2-(3,5-dimethoxyphenyl)naphthalene-2,6-dicarboxamide
Homo sapiens
pH 8.8, 37°C
0.0081
N2-(3-chlorobiphenyl-4-yl)naphthalene-2,6-dicarboxamide
Homo sapiens
pH 8.8, 37°C
0.045
N2-(4-(aminomethyl)phenyl)naphthalene-2,6-dicarboxamide trifluoroacetate
Homo sapiens
pH 8.8, 37°C
0.015
N2-phenylnaphthalene-2,6-dicarboxamide
Homo sapiens
pH 8.8, 37°C
0.0113
NCI004367
Homo sapiens
pH 7.4, 37°C
0.0063
NCI0135766
Homo sapiens
pH 7.4, 37°C
0.0284
NCI0144205
Homo sapiens
pH 7.4, 37°C
0.009
NCI0666712
Homo sapiens
pH 7.4, 37°C
0.0081
[2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]phenyl]acetic acid
Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.000098
2-([6-[(3'-carbamimidoylbiphenyl-3-yl)oxy]-3,5-difluoro-4-methylpyridin-2-yl]oxy)-4-(dimethylamino)benzoic acid

Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.000098
2-([6-[(3'-carbamimidoylbiphenyl-3-yl)oxy]-3,5-difluoro-4-methylpyridin-2-yl]oxy)-4-(dimethylamino)benzoic acid
Homo sapiens
pH 8.8, 37°C
0.00024
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-methylbenzoic acid

Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.00024
2-[(6-[[3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-methylbenzoic acid
Homo sapiens
pH 8.8, 37°C
0.000039
2-[(6-[[5-amino-3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-methylbenzoic acid

Homo sapiens
-
pH not specified in the publication, temperature not specified in the publication
0.000039
2-[(6-[[5-amino-3'-(aminomethyl)biphenyl-3-yl]oxy]-3,5-difluoropyridin-2-yl)oxy]-4-methylbenzoic acid
Homo sapiens
pH 8.8, 37°C
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
-
silencing of transmembrane protein Notch1 by siRNA results in significant reduction in the expression of uPA and matrix metalloproteinase-9 gene transcripts. Knock-down of Notch also reduces the mRNA expression and protein levels of uPA and matrix metalloproteinase-9
brenda
-
melanoma cell
brenda
-
-
brenda
generated from human induced pluripotent stem cells, i.e. from FXS males (HEL69.6, HEL70.3, HEL70.6, and HEL100.2) and healthy male donors (HEL23.3, HEL24.3, HEL46.11, PO2/UEF-3A, and PO4/UEF-3B). Increase in extracellular uPA in fragile X syndrome (FXS) astrocyte cultures
brenda
-
uPA shows extensive colocalization with alpha-granule proteins in both cultured Quebec platelet disease megakaryocytes and platelets, and with plasminogen in Quebec platelet disease platelets
brenda
-
plasma cell
brenda
-
-
brenda
-
-
brenda
-
-
brenda
-
a murine microglial cell line
brenda
-
-
brenda
-
standard model of the balloon catheter injury of the carotid. Periadventitial application of recombinant uPA significantly reduces lumen size and vessel area encompassed by the external lamina both 1 and 4 days after treatment.In fallatory cells accumulate in the arterial adventitia at both 1 and 4 days after uPA treatment. Four days after injury in uPA-treated arteries, 3 proinflammatory and 2 oxidation-related genes are differentially expressed
brenda
-
-
brenda
-
-
brenda
-
-
brenda
-
very low enzyme content
brenda
-
-
brenda
-
-
brenda
-
-
brenda
-
-
brenda
-
-
brenda
-
primary
brenda
-
pulmonary arterial
brenda
-
outer root sheath keratinocyte of vibrissa follicle
brenda
-
uPA, seprase and pipeptidylaminopeptidase IV immunoreactivity is found in dysplastic and cancer cells as well as in stromal cells adjacent to dysplasia and cancer sites, but not in normal epithelium. There is a significant association between uPA expression and sex, tumor size and histological classification in carcinomas. Squamous cell carcinoma lines display higher levels of uPA, seprase and dipeptidylaminopeptidase IV than normal esophageal epithelial cell lines
brenda
-
-
brenda
-
-
brenda
-
-
brenda
-
-
brenda
-
-
brenda
-
human recombinant uPA induces stem cell migration. Retrovirus-mediated overexpression of uPA and uPA receptor in neuroblastoma NB-1691 cells induced robust migration of stem cells toward NB-1691 cell-conditioned media, compared with media derived from wild-type NB-1691 cells. Depletion of uPA from PC-3 prostate cancer cell-conditioned medium blocks stem cell migration
brenda
-
-
brenda
-
high enzyme level
brenda
-
primary
brenda
-
-
brenda
-
-
brenda
-
a hepatic stellate cell line
brenda
-
-
brenda
-
-
brenda
-
silencing of transmembrane protein Notch1 by siRNA results in significant reduction in the expression of uPA and matrix metalloproteinase-9 gene transcripts. Knock-down of Notch also reduces the mRNA expression and protein levels of uPA and matrix metalloproteinase-9
brenda
-
human lung cancer cell line H1415, activation of uPA and uPA receptor in malignant solid tumors augments neural and mesenchymal stem cell tropism. Expression levels of uPA receptor on human solid tumor cell linescorrelates with levels of uPA and soluble uPA receptor in tumor cell-conditioned media
brenda
-
lung fibroblast cell line
brenda
-
-
brenda
-
subline of MDA-MB-231, stably transfected with the bacterial lacZ gene
brenda
-
-
brenda
-
CD34+ progenitor cells express normal amounts of uPA, while their differentiation into megakaryocytes results in abnormally increased expression of the uPA gene but not the flanking genes for vinculin or calcium/calmodulin-dependent protein kinase IIgamma on chromosome 10. uPA shows extensive colocalization with alpha-granule proteins in both cultured Quebec platelet disease megakaryocytes and platelets, and with plasminogen in Quebec platelet disease platelets
brenda
-
-
brenda
-
brenda
-
brenda
-
uPA localizes strongly to natural killer cells of the placental bed, especially at 8-10 weeks of gestation. uPA activity is similar in uterine natural killer cell culture supernatant compared with total unseparated decidual cells. uPA receptor in uterine natural killer cell lysates is significantly stronger than in total decidual cell lysates. Inhibitors PAI-1 and PAI-2 are not detected in uterine natural killer cell culture supernatants
brenda
-
retrovirus-mediated overexpression of uPA and uPA receptor in neuroblastoma NB-1691 cells induced robust migration of stem cells toward NB-1691 cell-conditioned media, compared with media derived from wild-type NB-1691 cells
brenda
-
activation of uPA and uPA receptor in malignant solid tumors augments neural and mesenchymal stem cell tropism. Expression levels of uPA receptor on human solid tumor cell lines correlates with levels of uPA and soluble uPA receptor in tumor cell-conditioned media
brenda
-
activation of uPA and uPA receptor in malignant solid tumors augments neural and mesenchymal stem cell tropism. Expression levels of uPA receptor on human solid tumor cell lines correlates with levels of uPA and soluble uPA receptor in tumor cell-conditioned media
brenda
-
-
brenda
-
study on cocaine-induced conditioned-place preference in rats with bilateral intra-accumbens injections of uPA-expressing lentiviral vectors. Overexpression of uPA in the nucleus accumbens significantly augments cocaine-induced place preference. Reinstatement with a low dose of cocaine produces significantly greater preference to the cocaine-associated context. Inhibition of tuPA expression using doxycycline abolishes the augmented acquisition produced by overexpression of uPA but not the expression of the cocaine-induced conditioned-place preference. Cocaine-induced cocaine-induced conditioned-place preference and reinstatement may be dependent on active extracellular uPA
brenda
-
-
brenda
-
-
brenda
-
-
brenda
-
-
brenda
-
-
brenda
-
-
brenda
-
brenda
-
granulocytes, monocytes
brenda
-
uPA localizes strongly to natural killer cells of the placental bed, especially at 8-10 weeks of gestation. uPA activity is similar in uterine natural killer cell culture supernatant compared with total unseparated decidual cells. uPA receptor in uterine natural killer cell lysates is significantly stronger than in total decidual cell lysates. Inhibitors PAI-1 and PAI-2 are not detected in uterine natural killer cell culture supernatants
brenda
-
brenda
-
-
brenda
-
overexpression of uPA mRNA in various stages of surgically excised pterygia specimens and cultured pterygium fibroblasts, expression is increased significantly following the progression of the pterygium, quantitative real-time PCR analysis, overview
brenda
-
-
brenda
-
-
brenda
-
-
brenda
-
-
brenda
-
activation of uPA and uPA receptor in malignant solid tumors augments neural and mesenchymal stem cell tropism. Expression levels of uPA receptor on human solid tumor cell lines correlates with levels of uPA and soluble uPA receptor in tumor cell-conditioned media
brenda
-
basal keratinocytes of epidermis
brenda
-
brenda
-
in sputum derived from patients with house dust mite allergic asthma, the medium concentration of uPA is significantly greater than in healthy control patients. The sputum concentration of uPA correlates with sputum total cell count and with logarithmically transformed exhaled nitric oxide concentration, but not with FEV1 or bronchial reactivity to histamine. Tge effect of uPA seems to be independent of its fibrinolytic activity
brenda
-
-
brenda
-
-
brenda
-
-
brenda
-
-
brenda
myeloid leukemia cell line
brenda
-
fibroblast cell
brenda
-
-
brenda
-
activation of uPA and uPA receptor in malignant solid tumors augments neural and mesenchymal stem cell tropism. Expression levels of uPA receptor on human solid tumor cell lines correlates with levels of uPA and soluble uPA receptor in tumor cell-conditioned media
brenda
-
brenda
-
-
brenda
-
-
brenda
-
-
brenda
-
-
brenda
-
lung fibroblast cell line
brenda
-
-
brenda
-
-
brenda
-
A431 epidermoid carcinoma cells
brenda
-
A-549 alveolar epithelial cell cultured on a fibrin matrix, stimulation by interleukin 1beta results in increased levels of enzyme in culture supernatant
brenda
-
-
brenda
A0A337S474
serum levels of uPA are measured using a feline-specific uPA sandwich enzyme-linked immunosorbent assay
brenda
-
-
brenda
-
patients with common variable immunodeficiency show increased levels of plasma uPA
brenda
-
brenda
-
-
brenda
-
-
-
brenda
-
-
brenda
-
-
brenda
-
from ME7-infected mice
brenda
-
from ME7-infected mice
-
brenda
-
brain tissue of thermally injured rats displays an increase in the brain water content and the presence of Evans blue, temporally associated with an increased expression of endogenous tPA and uPA. Peripheral thermal injury does induce an increase in the permeability of the blood brain barrier
brenda
-
induction of lateral fluid percussion brain injury results in up-regulation of uPA and ERK mitogen-activated protein kinase. uPA contributes to the impairment of sodium nitroprusside and PGE2-mediated cerebrovasodilatation through activation of low-density lipoprotein receptor and ERK mitogen-activated protein kinase
brenda
-
-
brenda
-
-
brenda
-
-
brenda
-
-
brenda
-
brenda
-
-
-
brenda
-
-
brenda
-
differences in uPA and uPAR expression and clinicopathologic features of patients with mismatch repair-proficient colorectal cancer, immunohistochemic tissue analysis, overview
brenda
-
-
brenda
-
purified enzyme
brenda
-
-
brenda
-
recombinant two-chain and single-chain enzyme
brenda
-
single chain, activated urokinase
brenda
-
-
brenda
-
recombinant, active
brenda
-
recombinant pro-uPA, expressed in Escherichia coli
brenda
-
pro-uPA and mature uPA
brenda
-
brenda
-
purified enzyme
brenda
-
-
brenda
-
silencing of transmembrane protein Notch1 by siRNA results in significant reduction in the expression of uPA and matrix metalloproteinase-9 gene transcripts. Knock-down of Notch also reduces the mRNA expression and protein levels of uPA and matrix metalloproteinase-9
brenda
-
-
brenda
-
-
brenda
-
established by a spontaneous transformation of endothelial cells of a human umbilical vein, with a novel substitution in the kringle structure
brenda
-
A-549 alveolar epithelial cell cultured on a fibrin matrix, stimulation by interleukin 1beta results in increased levels of enzyme in culture supernatant
brenda
-
gastric biopsy probes. uPA, uPA receptor and inhibitor PAI-1 are expressed in H+/K+ ATPase- and vesicular monoamine transporter 2-expressing cells. uPA is also expressed in pepsinogen- and uPA receptor-containing cells. In each case, expression is increased in response to Helicobacter pylori, and for uPA, but not the receptor or PAI-1, requires the virulence factor CagE. Helicobacter pylori also stimulates soluble and cell surface-bound uPA activity
brenda
-
-
brenda
-
outermost epithelial cells of the hair follicle
brenda
-
-
brenda
-
-
-
brenda
-
-
brenda
-
primary
brenda
-
-
brenda
-
lung
brenda
-
-
brenda
corneal, extracellular stroma, derived from uPA+/+ and uPA-/- mice
brenda
-
-
-
brenda
-
-
brenda
-
uPAR is overexpressed in outer root sheath and interfollicle epidermis, and expressed in the outermost epithelial cells of the hair follicle and the basal keratinocytes of epidermis, the expression decreases with the development of the hair follicle
brenda
-
outer root sheath keratinocyte of vibrissa follicle
brenda
-
implanted subcutaneously or orthotopically to nude mice
brenda
-
-
brenda
-
hearts with end-stage failure and fibrosis have macrophage accumulation and elevated plasminogen activator activity, mechanisms that link macrophage accumulation and plasminogen activator activity with cardiac fibrosis, overview
brenda
-
-
brenda
-
treatment with H2O2 upregulates expression of uPA. Hepatocyte growth factor modulates Rac-1 regulated production of reactive oxygen species through activation of Akt and reactive oxygen species regulates uPA production via MAP kinase
brenda
-
-
brenda
-
treatment with H2O2 upregulates expression of uPA. Hepatocyte growth factor modulates Rac-1 regulated production of reactive oxygen species through activation of Akt and reactive oxygen species regulates uPA production via MAP kinase
brenda
-
-
brenda
-
brenda
-
-
brenda
-
fibrosarcoma cell
brenda
-
fibrosarcoma cell line
brenda
-
-
brenda
-
a fibrosarcoma cell line
brenda
-
colon adenocarcinoma cell
brenda
-
implanted subcutaneously or orthotopically to nude mice
brenda
-
brenda
-
-
brenda
-
-
brenda
-
cell surface
brenda
-
basal keratinocytes of epidermis at the hair follicle. Expression of uPA and uPA receptor is selectively induced at the very tip of the leading edge of the keratinocytes
brenda
-
outer root sheath keratinocyte of vibrissa follicle
brenda
-
-
brenda
-
tubule cells
brenda
-
-
brenda
-
in mice model for kidney ischemia reperfusion injury, deficiency for uPA receptor, but not uPA protects from ischemia reperfusion injury. In the allogenic kidney transplant model, uPA receptor but not uPA deficiency of the allograft causes superior recipient survival and strongly attenuates loss of renal function
brenda
-
-
brenda
-
matrix
brenda
-
-
brenda
-
-
-
brenda
-
-
brenda
-
enzyme level is extremely elevated in the edematous fluid of acutely injured lungs and pleurae
brenda
-
-
brenda
-
asthma model mice
brenda
-
asthma model mice
-
brenda
-
-
-
brenda
-
from bone-marrow
brenda
-
-
brenda
-
blood monocyte-derived
brenda
enzyme expression in atherosclerotic lesion macrophages
brenda
-
-
brenda
-
enzyme expression in atherosclerotic lesion macrophages
brenda
-
-
-
brenda
-
enzyme expression in atherosclerotic lesion macrophages
-
brenda
-
-
brenda
-
breast cancer cell
brenda
-
-
brenda
-
adriamycine-resistant subline of MCF-7
brenda
-
-
brenda
-
breast cancer cell
brenda
-
-
brenda
-
a breast cancer cell line
brenda
-
-
brenda
-
-
brenda
-
-
-
brenda
-
-
brenda
-
brenda
-
-
brenda
-
-
-
brenda
-
-
brenda
-
-
brenda
-
-
-
brenda
-
-
brenda
-
-
brenda
-
-
brenda
-
cerebral cortical, release of enzyme during the recovery phase from ischemic stroke in vivo or hypoxia in vitro
brenda
-
cerebral cortical, release of enzyme during the recovery phase from ischemic stroke in vivo or hypoxia in vitro
-
brenda
analysis of serum and tissue uPA/uPAR expression in dogs with appendicular osteosarcoma, overview
brenda
-
-
brenda
-
brenda
-
-
brenda
-
brenda
-
-
brenda
-
in a severe combined immunodeficient-human mouse model, PC-3 cells are the major source of uPA in the experimental bone tumor. Injection of uPA-silenced PC-3 cells in bone xenografts results in significant reduction of bone tumor burdens and protection of trabecular bones from destruction. The suppressed tumor growth is associated with the level of uPA expression but not with its activity. An increase in the expression of PAI-1, the endogenous uPA inhibitor, is found during in vitro tumor-stromal interactions. Up-regulation of PAI-1 in bone stromal cells and preosteoclasts/osteoblasts is due to soluble factor(s) released by PC cells, and the enhanced PAI-1 expression in turn stimulated PC cell migration
brenda
-
activation of uPA and uPA receptor in malignant solid tumors augments neural and mesenchymal stem cell tropism. Expression levels of uPA receptor on human solid tumor cell lines correlates with levels of uPA and soluble uPA receptor in tumor cell-conditioned media. Depletion of uPA from PC-3 prostate cancer cell-conditioned medium blocks stem cell migration
brenda
-
silencing of transmembrane protein Notch1 by siRNA results in significant reduction in the expression of uPA and matrix metalloproteinase-9 gene transcripts. Knock-down of Notch also reduces the mRNA expression and protein levels of uPA and matrix metalloproteinase-9
brenda
-
-
brenda
-
brenda
-
-
brenda
-
expression levels of urokinase-type plasminogen activator system in radical prostatectomy specimens, overview
brenda
-
-
brenda
-
-
brenda
-
-
-
brenda
-
brenda
-
-
-
brenda
-
brenda
-
brenda
-
-
brenda
-
-
-
brenda
-
-
brenda
-
airway
brenda
-
-
brenda
-
-
brenda
-
breast cancer cell
brenda
-
-
brenda
-
a histiocytic lymphoma cell line
brenda
-
lymphoma cells
brenda
-
-
brenda
-
-
brenda
-
brenda
-
-
brenda
-
-
brenda
-
-
brenda
-
-
brenda
additional information

serum uPA level is significantly higher in dogs with osteosarcoma than clinically healthy control dogs
brenda
additional information
-
uPA is expressed differentially in colon and rectal cancers, expression analysis, overview
brenda
additional information
-
urokinase is overexpressed in several tumors
brenda
additional information
-
no or poor expression of uPA in LS513 normal fibroblast
brenda
additional information
-
increased uPA expression in several epileptogenic pathologies, including hippocampal sclerosis, and in developmental glioneuronal lesions, such as focal cortical dysplasia, cortical tubers in patients with the tuberous sclerosis complex and in gangliogliomas, immunohistochemic analysis, overview
brenda
additional information
-
uPA and uPA receptor are expressed during invasive migration of the hair follicle, not under normal circumstances. uPAR promotes the invasive migration of hair follicles synergizing in manner dependent and independent of uPA during human prenatal morphogenesis
brenda
additional information
-
strong expression of uPA in addition to a Gleason score, positive surgical margin, and lymph node metastasis
brenda
additional information
-
quantitative and immunuhistochemic analysis of the urokinase plasminogen activator, its cognate receptor uPAR and the uPA inhibitors PAI-1 and PAI-2 in normal human testis and seminomas, overview
brenda
additional information
-
the uPA receptor, a GPI-linked cell surface protein, occurs in macrophages infiltrating the central nervous system, and in the cerebrospinal fluid during a number of CNS pathologies
brenda
additional information
-
uPA expression analysis in lung, overview
brenda
additional information
-
uPA expression analysis in lung, overview
-
brenda
additional information
-
the uPA receptor, a GPI-linked cell surface protein, occurs in macrophages infiltrating the central nervous system, and in the cerebrospinal fluid during a number of CNS pathologies
-
brenda
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
evolution

the enzyme belongs to the trypsin superfamily of enzymes
evolution
biochemical and structural analyses suggest that plasminogen activators coevolved with their cognate protein substrates and inhibitors. The binding interfaces of uPA:plasminogen and uPA:PAI-1 may have coevolved to maintain tight interactions
malfunction

-
inhibition of u-PAR and u-PA attenuates lipopolysaccharid-mediated tumour cell adhesion and invasion
malfunction
-
a wide variety of disorders are associated with an imbalance in the plasminogen activator system, including inflammatory diseases, atherosclerosis, intimal hyperplasia, the response mechanism to vascular injury, and restenosis. uPA is implicated in the stimulation of angiogenesis, detailed overview
malfunction
-
urokinase plasminogen activator receptor, uPAR, deficient mice show reduced neutrophil recruitment and less severe lung injury during hyperoxia compared to wild-type mice, uPAR deficiency diminishes KC and IL-6 release and enhances activation of pulmonary coagulation, overview
malfunction
-
a wide variety of disorders are associated with an imbalance in the plasminogen activator system, including inflammatory diseases, atherosclerosis, intimal hyperplasia, the response mechanism to vascular injury, and restenosis. uPA is implicated in the stimulation of angiogenesis, detailed overview
malfunction
-
a wide variety of disorders are associated with an imbalance in the plasminogen activator system, including inflammatory diseases, atherosclerosis, intimal hyperplasia, the response mechanism to vascular injury, and restenosis. uPA is implicated in the stimulation of angiogenesis, detailed overview
malfunction
-
uPA-dependent cleavage of alpha6integrin is involved in onset and progression of osseous metastases. Alpha6 integrin cleavage permits extravasation of human prostate cancer cells from circulation to bone and can be manipulated to prevent metastasis
malfunction
-
uPA transcription and activity is only markedly increased during chronic neurodegeneration, not during acute intracerebral lipopolysaccharide-induced or acute kainate-induced neurodegeneration. Increase in total plasminogen activation with progression of prion disease is apparent in both soluble and membrane fractions
malfunction
-
uPA is involved in adhesion, migration and invasion of hepatic Hep-G2 cancer cells, inhibition and downregulation of uPA by plumbagin also leads to inhibition of adhesion, migration and invasion by plumbagin in HepG2 cells, overview
malfunction
-
urokinase plasminogen activator is related to tumor metastasis
malfunction
-
pancreatic ductal adenocarcinoma, PDAC, expresses high levels of urokinase-type plasminogen activator, its receptor uPAR, and plasminogen activator inhibitor-2, which may play an important role in PDAC progression. Proliferation and migration of pancreatic adenocarcinoma cells via regulation of ERK/p38 signaling is inhibited by suppression of urokinase plasminogen activator receptor. Effects of uPAR in the uPA system on cancer cell development and progression, overview
malfunction
-
urokinase-type plasminogen activator receptor, u-PAR, is overexpressed in many human malignant tumors including oral squamous cell carcinoma and plays an important role in a variety of cancer key cellular events as a versatile signaling orchestrator. MMP-9, MMP-2 and u-PA enzymatic activities are significantly reduced in u-PAR-specific siRNA cells. RNAi targeting u-PAR can effectively inhibit the metastasis and progression of oral squamous cell carcinoma in vivo
malfunction
-
urokinase plasminogen activator mediates impairment of hypercapnic and hypotensive cerebrovasodilation and pial artery dilation after cerebral hypoxia/ischemia, which is prevented by inhibition of integrin alphanubeta3, overview. Inhibition of uPA and integrin signaling may preserve cerebrohemodynamic control after hypoxia/ischemia
malfunction
-
binding of urokinase-type plasminogen activator, uPA, to the uPA receptor, uPAR, existing on the surface of cancer cell is considered to be a trigger for cancer invasions
malfunction
-
uPA stimulates glioblastoma multiforme cell invasiveness, in sphingosine-1-phosphate-induced invasion using a spheroid invasion assay
malfunction
-
uPA overexpression in brain cortex and hippocampus is involved in epileptic pathology
malfunction
-
uPA is involved in cell invasion of breast cancer cells, uPA is a key regulator of breast cancer invasion and metastasis, overview
malfunction
-
excessive fibrinolysis in monoclonal antibody light chain-amyloidosis is induced by urokinae-type plasminogen activator from bone marrow plasma cells, uPA expression analysis, overview
malfunction
-
uPA is an important protease believed responsible for several tumour characteristics through its activation of certain proteases and growth factors. uPA is essential in the degradation of peritumour extracellular matrix. uPA, induced by PGE2 from stromal fibroblasts surrounding lung tumour, thus appears to play an important role through EP receptors
malfunction
-
overexpression of uPAR promotes the invasive migration of hair follicle into the dermis in an uPA-dependent and an uPA-independent, ERK-dependent manner during human prenatal development
malfunction
-
the urokinase plasminogen activating system is implicated in neoplastic progression and high tissue levels of uPAS components correlate with a poor prognosis in different human cancers
malfunction
-
upregulation of the uPA system is correlated with malignancy of various carcinomas
malfunction
-
at pathophysiological concentrations above 20 nM, uPA inhibits contractility and increases vascular permeability
malfunction
-
livers of uPA-ablated mice elevated TIMP-1 levels do not trigger HGF signalling and do not promote metastasis of a murine T-lymphoma cell line, decreased TIMP-1-induced tumour cell scattering in uPA knockout mice. In contrast, lack of tumour cell-derived uPA induced by gene silencing do not interfere with this pro-metastatic pathway
malfunction
-
macrophage-specific uPA overexpression accelerates atherosclerosis and causes aortic root dilation in fat-fed Ldlr-/-mice. Macrophage-expressed uPA accelerates atherosclerosis by stimulation of lesion progression rather than initiation and causes disproportionate lipid accumulation in early lesions. uPA-accelerated atherosclerosis and aortic dilation are largely, if not completely, independent of uPA receptor, uPAR. In the absence of uPA overexpression, however, uPAR contributes modestly to both atherosclerosis and aortic dilation
malfunction
-
macrophage adhesion to vitronectin is blocked by plasminogen activator inhibitor-1, which is also able to enhance in turn the two-dimensional migration on this matrix protein
malfunction
-
genetic deficiency of enzyme or urokinase plasminogen activator receptor abrogates functional recovery after acute ischemic stroke
malfunction
suppression of uPA retards development of pancreatic cancer in nude mice and increases sensitization to gemcitabine
malfunction
-
overexpression of urokinase plasminogen activator in macrophages induces spontaneous macrophage accumulation and fibrosis specific to the heart in mice
malfunction
both C57/black 6J, and AlbPLG1 mice expressing the human plasminogen transgene, are significantly more susceptible to invasive Group A Streptococcus strain 5448 disease than enzyme-deficient uPA-/- mice. The observed decrease in virulence in uPA-/- mice correlates directly with a decrease in bacterial dissemination and reduced cell surface plasmin accumulation by Group A Streptococci
malfunction
-
in enzyme knockout mice, the number of peritoneal macrophages is lower by 30% than the peritoneal macrophages harvested from wild-type C57BL/6 mice
malfunction
-
enzyme receptor defciient mice show no lipid droplets in their livers compared to wild-type C57BL/6 mice and the triglyceride levels are significantly lower, phenotype, overview
malfunction
increased expression of urokinase plasminogen activator (uPA), in fragile X syndrome (FXS) astrocytes, modulating degradation of the extracellular matrix. Several pathways associated with uPA and its receptor function are activated in FXS astrocytes. Increased uPA augmented neuronal phosphorylation of TrkB within the docking site for the phospholipase-Cgamma1 (PLCgamma1), indicating effects of uPA on neuronal plasticity. Increased uPA in human FXS astrocytes modulate astrocytic responses and neuronal plasticity, overview
malfunction
inhibition of the catalytic activity of uPA is naturally caused by the serine protease inhibitors plasminogen activator inhibitor-1 and-2 (PAI-1 and PAI-2). PAI-1 is the major inhibitor, which makes the conversion to plasmin a highly controlled event
malfunction
-
retinitis pigmentosa (RP) is characterized by progressive loss of vision due to photoreceptor degeneration leading to secondary inflammation. The urokinase-type plasminogen activator (uPA) system contributes to retinal inflammation via HIF-1 regulation of the uPA/uPAR gene expression in the retina and extremely low levels of uPA and its receptor uPAR. HIF-1 degeneration leads to reduced uPA/uPAR expression levels, overview. uPAR is overexpressed in response to ischaemic conditions in ocular pathology. In tumour angiogenesis, HIF-1 mediates the transcription of uPA/uPAR genes during hypoxia
malfunction
urokinase-type plasminogen activator (uPA) deficiency might promote the interaction between collagen and Endo180. Expression of alpha-SMA is thus negatively regulated by uPA through targeting of Endo180 and uPAR. Loss of uPA appears to protect the integrity of full-length Endo180 and uPAR and thereby increase alpha-SMA expression via enhancement of TGF-beta signaling
malfunction
overexpression of uPA is relevant to some malignant tumors as well as poor prognosis
malfunction
A0A337S474
the average serum concentration of uPA in cancerous cats differs from that of healthy cats but is not significantly influenced by cats' clinicopathological parameters or by the presence of metastases, relevance of uPAS in feline carcinogenesis
malfunction
-
uPA is rapidly neutralised in circulation by plasminogen activator inhibitors
malfunction
morin inhibits osteosarcoma migration and invasion by suppressing urokinase plasminogen activator through a signal transducer and an activator of transcription 3 (STAT3), whiich contributes to the antimetastatic property of morin in human osteosarcoma cells by reducing uPA
malfunction
-
urokinase plasminogen activator receptor, uPAR, deficient mice show reduced neutrophil recruitment and less severe lung injury during hyperoxia compared to wild-type mice, uPAR deficiency diminishes KC and IL-6 release and enhances activation of pulmonary coagulation, overview
-
malfunction
-
uPA transcription and activity is only markedly increased during chronic neurodegeneration, not during acute intracerebral lipopolysaccharide-induced or acute kainate-induced neurodegeneration. Increase in total plasminogen activation with progression of prion disease is apparent in both soluble and membrane fractions
-
malfunction
-
macrophage-specific uPA overexpression accelerates atherosclerosis and causes aortic root dilation in fat-fed Ldlr-/-mice. Macrophage-expressed uPA accelerates atherosclerosis by stimulation of lesion progression rather than initiation and causes disproportionate lipid accumulation in early lesions. uPA-accelerated atherosclerosis and aortic dilation are largely, if not completely, independent of uPA receptor, uPAR. In the absence of uPA overexpression, however, uPAR contributes modestly to both atherosclerosis and aortic dilation
-
malfunction
-
macrophage adhesion to vitronectin is blocked by plasminogen activator inhibitor-1, which is also able to enhance in turn the two-dimensional migration on this matrix protein
-
malfunction
-
in enzyme knockout mice, the number of peritoneal macrophages is lower by 30% than the peritoneal macrophages harvested from wild-type C57BL/6 mice
-
malfunction
-
enzyme receptor defciient mice show no lipid droplets in their livers compared to wild-type C57BL/6 mice and the triglyceride levels are significantly lower, phenotype, overview
-
malfunction
-
genetic deficiency of enzyme or urokinase plasminogen activator receptor abrogates functional recovery after acute ischemic stroke
-
malfunction
-
retinitis pigmentosa (RP) is characterized by progressive loss of vision due to photoreceptor degeneration leading to secondary inflammation. The urokinase-type plasminogen activator (uPA) system contributes to retinal inflammation via HIF-1 regulation of the uPA/uPAR gene expression in the retina and extremely low levels of uPA and its receptor uPAR. HIF-1 degeneration leads to reduced uPA/uPAR expression levels, overview. uPAR is overexpressed in response to ischaemic conditions in ocular pathology. In tumour angiogenesis, HIF-1 mediates the transcription of uPA/uPAR genes during hypoxia
-
metabolism

-
involvement of the uPAR/uPA system in CNS function and pathology, overview
metabolism
-
NFkappaB-dependent regulation of urokinase plasminogen activator
metabolism
a poor prognosis of pancreatic ductal adenocarcinoma is correlated with increased expression of urokinase plasminogen activator
metabolism
the urokinase plasminogen activation pathways are comprised of urokinase-type plasminogen activator, its plasmalemmal receptor, and extracellular plasminogen
metabolism
-
the enzyme uPA is a serine protease, and together with its membraneassociated receptor uPAR, is part of the uPA/uPAR system, which is an important component of the fibrinolytic system
metabolism
extracellular histones inhibit tissue plasminogen activator (t-PA)-mediated fibrinolysis by modifying fibrin structure and rheological properties, while urokinase (u-PA) is activated. Histones delay t-PA- and u-PA-mediated fibrinolysis but strongly accelerate single chain precursor scu-PA-driven clot lysis through the enhancement of scu-PA to u-PA conversion. This effect requires a plasma factor identified as factor seven activating protease (FSAP). Histones promote the activation of plasma FSAP, which is reduced by DNA
metabolism
plasminogen is an inactive zymogen that can be activated by a limited proteolysis reaction catalyzed by two types of plasminogen activators (PA), namely, tissue-type PA (tPA, EC 3.4.21.68) and urokinase-type PA (uPA). Circulating tPA is mainly involved in the activation of plasminogen during blood clotting in the degradation and dissolution of fibrin while uPA is involved in various aspects of cellular migration and regulation. Urokinase-type plasminogen activator is closely related to male reproduction, such as sperm progressive motility, acrosomal reaction, capacitation, chemotactic response, and fertilization
metabolism
-
the uPA system and inflammation, overview
metabolism
the expression of alpha-SMA is negatively regulated by the targeting of Endo180 and uPAR by uPA in corneal fibroblasts cultured in a collagen gel
metabolism
A0A337S474
the urokinase plasminogen activator system (uPAS) is one of the extracellular matrix proteolytic systems involved in several physiological and pathological conditions concerning the basal membrane and extracellular matrix (ECM) remodeling, such as angiogenesis, cancer invasion, and metastasis. This system comprises the serine protease urokinase plasminogen activator (uPA), its cell membrane receptor (uPAR), the tissue plasminogen activator and its two main inhibitors, and the plasminogen activator inhibitors PAI-1 and PAI-2
metabolism
-
single-chain zymogen pro-urokinase (pro-uPA) and rtPA (EC 3.4.21.68) appear to be complementary and synergistic in their action. In contrast to tPA, uPA has lower affinity for plasminogen and does not require fibrin as a cofactor. Similar to tPA, uPA is rapidly neutralised in circulation by plasminogen activator inhibitors
metabolism
-
involvement of the uPAR/uPA system in CNS function and pathology, overview
-
metabolism
-
plasminogen is an inactive zymogen that can be activated by a limited proteolysis reaction catalyzed by two types of plasminogen activators (PA), namely, tissue-type PA (tPA, EC 3.4.21.68) and urokinase-type PA (uPA). Circulating tPA is mainly involved in the activation of plasminogen during blood clotting in the degradation and dissolution of fibrin while uPA is involved in various aspects of cellular migration and regulation. Urokinase-type plasminogen activator is closely related to male reproduction, such as sperm progressive motility, acrosomal reaction, capacitation, chemotactic response, and fertilization
-
metabolism
-
the uPA system and inflammation, overview
-
physiological function

-
urokinase-type plasminogen activator induces BV-2 microglial cell migration through activation of matrix metalloproteinase-9
physiological function
-
the plasminogen system plays a crucial role in the repair of a variety of tissues, including skeletal muscle. uPA promotes muscle regeneration by activating hepatocyte growth factor, which, in turn, stimulates proliferation of myoblasts required for regeneration. uPA promotes myoblast proliferation in vitro through its proteolytic activity
physiological function
-
uPA is a multifunctional protein that in addition to its fibrinolytic and matrix degradation capabilities also affects growth factor bioavailability, cytokine modulation, receptor shedding, cell migration and proliferation, phenotypic modulation, protein expression, and cascade activation of proteases, inhibitors, receptors, and modulators. uPA is the crucial protein for neointimal growth and vascular remodeling. Mechanism of fibroblast-to-myofibroblast transformation induced by uPA. Detailed overview
physiological function
-
uPA is a multifunctional protein that in addition to its fibrinolytic and matrix degradation capabilities also affects growth factor bioavailability, cytokine modulation, receptor shedding, cell migration and proliferation, phenotypic modulation, protein expression, and cascade activation of proteases, inhibitors, receptors, and modulators. uPA is the crucial protein for neointimal growth and vascular remodeling. Mechanism of fibroblast-to-myofibroblast transformation induced by uPA. Detailed overview
physiological function
-
uPA is a multifunctional protein that in addition to its fibrinolytic and matrix degradation capabilities also affects growth factor bioavailability, cytokine modulation, receptor shedding, cell migration and proliferation, phenotypic modulation, protein expression, and cascade activation of proteases, inhibitors, receptors, and modulators. uPA is the crucial protein for neointimal growth and vascular remodeling. Mechanism of fibroblast-to-myofibroblast transformation induced by uPA. Detailed overview
physiological function
-
urokinase plasminogen activator receptor, u-PAR, binds u-PA and participates in plasminogen activation in addition to modulating several cellular processes such as adhesion, proliferation, and migration
physiological function
-
uPA elicits various cellular responses, involving the activation of distinct signaling pathways
physiological function
-
the urokinase plasminogen activator, uPA, system, comprising of uPA, its receptor uPAR and inhibitor, type 1 plasminogen activator inhibitor, PAI-1, plays a vital role in various biological processes involving extracellular proteolysis, fibrinolysis, cell migration and proliferation
physiological function
-
uPA is an important activator of fibrinolytic system
physiological function
-
uPA is a potent catalyst of extracellular proteolysis and manifests this action through the conversion of plasminogen into plasmin, which has a range of specificities
physiological function
-
the uPA-uPA receptor, uPAR, system plays a critical role in the regulation of cancer cell migration, extracellular matrix invasion, and metastasis. uPA binds with high affinity to a cell surface uPAR, that is a heavily glycosylated glycosylphosphatidylinositol-anchored protein formed by three cysteine-rich LY6-like extracellular domains. uPA-uPAR promotes extracellular proteolysis by regulating plasminogen activation, uPA-uPAR regulates cell-extracellular matrix interactions as an adhesion receptor for vitronectin and through its capacity to modulate integrin function, and uPA-uPAR regulates cell migration as a signal transduction molecule and by its intrinsic chemotactic activity. Src/MAP kinase, but not FAK and PI3K, is involved in ECRG2-regulated, uPA-dependent cell migration/invasion
physiological function
-
uPA binds to the urokinase receptor, uPAR, expressed on the surface of many cell types, that coordinates plasmin-mediated cell surface proteolysis for matrix remodeling and promotes cell adhesion by acting as a binding protein for vitronectin. Role of uPAR in the phagocytosis of apoptotic cells, a process termed efferocytosis, overview
physiological function
-
two-chain active uPA and uPA-PAI-1 enzyme-inhibitor complex induce phosphorylation of endothelial NOS-Ser1177 in pulmonary microvascular endothelial cells, which is followed by generation of NO and the nitrosylation and dissociation of beta-catenin from VE-cadherin, mechanism of uPA-induced pulmonary vascular permeability in vivo, overview. Effects of uPA-PAI-1 are abrogated by the nitric-oxide synthase inhibitor N-D-nitro-L-arginine methyl ester. The PI3K/Akt pathway is not essential for uPA-induced phosphorylation of eNOS
physiological function
-
urokinase-type plasminogen activator is a protease involved in tissue remodeling and cell migration, increased expression of uPA in pterygium may covert plasminogen to plasmin, degrade extracellular matrixes, stimulate cell migration, induce angiogenesis, and plays an important role in the development and progression of pterygium
physiological function
-
uPA limits the accretion of fibrin after lung injury. uPA regulates the in vitro pulmonary arterial contractility induced by phenylephrine in a dose-dependent manner through two receptor-dependent pathways, and regulates vascular contractility and permeability in vivo. Physiological concentrations of uPA below 1 nM stimulate the contractility of pulmonary arterial rings induced by phenylephrine through the low-density lipoprotein receptor-related protein receptor. The pro-contractile effect of uPA is independent of its catalytic activity. The inhibition of vascular contractility and increase of vascular permeability is mediated through a two-step process that involves docking to N-methyl-Daspartate receptor-1 on pulmonary vascular smooth muscle cells, and requires catalytic activity
physiological function
-
plasmin and urokinase-type plasminogen activator are ubiquitous proteases that regulate the extracellular environment and activate each other through proteolytic cleavage. Although neither plasmin nor urokinase-type plasminogen activator exhibit allosteric cooperativity, modeling shows that cooperativity occurs at the system level because of substrate competition, computational simulations and bifurcation analysis, overview. Ultrasensitive, bistable activation of UPA-PLS is possible in the presence of substrate competition
physiological function
-
urokinase plasminogen activator inhibits HIV virion release from macrophage-differentiated chronically infected cells via activation of RhoA and PKCepsilon. Interaction of urokinase-type plasminogen activator with its cell surface receptor favours virion accumulation in such subcellular compartment in primary monocyte-derived macrophages and chronically infected promonocytic U1 cells differentiated into macrophage-like cells by stimulation with phorbol myristate acetate, PMA, uPA induces actin rearrangement in PMA stimulated U1 cells. uPA/uPAR interaction leads to the redirection of virion accumulation in intra-cytoplasmic vesicles. Anti-HIV effect of uPA is mediated by RhoA and PKCepsilon, but not by PKCdelta. uPA induces activation of RhoA, and of PKC epsilon and delta isoforms
physiological function
-
uPA is a crucial protagonist for the tissue inhibitor of metalloproteinases-1, TIMP-1, induced modulation of a pro-metastatic microenvironment in the liver of mice. Elevated levels of TIMP-1 render the liver more susceptible to metastasis by triggering urokinase plasminogen activator expression as well as hepatocyte growth factor signalling, thereby leading to the fatal scattered infiltration of metastasizing tumour cells throughout the parenchyma of the target organ. Host uPA is necessary for the recruitment of neutrophilic granulocytes and the associated increase of HGF in livers with elevated TIMP-1 levels
physiological function
-
uPA is a crucial protagonist for the tissue inhibitor of metalloproteinases-1, TIMP-1, induced modulation of a pro-metastatic microenvironment in the liver of mice. Elevated levels of TIMP-1 render the liver more susceptible to metastasis by triggering urokinase plasminogen activator expression as well as hepatocyte growth factor signalling, thereby leading to the fatal scattered infiltration of metastasizing tumour cells throughout the parenchyma of the target organ. Host uPA is necessary for the recruitment of neutrophilic granulocytes and the associated increase of HGF in livers with elevated TIMP-1 levels
physiological function
-
urokinase-type plasminogen activator is involved in diverse physiologic and pathophysiologic processes, including fibrinolysis, cell migration and adhesion, and inflammation, thereby playing a role in efferocytosis. uPA inhibits the uptake of apoptotic neutrophils, suggest a novel mechanism by which elevated levels of uPA may participate in enhancing the duration and severity of inflammatory processes, such as acute lung injury. The phagocytosis of apoptotic neutrophils by macrophages is significantly inhibited by uPA, the process requires the kringle domain of uPA, and involves alphaVbeta3 integrin and vitronectin. But protease activity is not required for uPA to inhibit the engulfment of apoptotic neutrophils by macrophages, overview. Wild-type and inactive uPA are able to inhibit phagocytosis of apoptotic neutrophils by macrophages
physiological function
-
the urokinase plasminogen activator system is implicated in cell migration and cancer metastasis
physiological function
-
the urokinase plasminogen activator/uPA receptor/plasminogen system is involved in the development of atherosclerosis and aneurysms, modeling, overview
physiological function
plasminogen activator, together with urokinase-type plasminogen activator inhibitor-1, PAI-1, plays a pivotal role in fibrinolysis, cell migration, and tissue remodeling
physiological function
-
activation of alphabetagamma-epithelial sodium channel specifically by the enzyme may contribute to fluid clearance under physiological conditions and in injured tissues, multifaceted mechanisms for enzyme-mediated up-regulation of the epithelial sodium channel, which form the cellular and molecular rational for the beneficial effects of urokinase in mitigating mortal pulmonary edema and pleural effusions, overview
physiological function
-
urokinase plasminogen activator and its receptor coordinate a plasmin-mediated proteolytic cascade that is implicated in cell adhesion, cell motility, and matrix breakdown, for example, during inflammation. The enzyme is a central regulator of macrophage three-dimensional invasion, matrix degradation, and adhesion. Macrophage adhesion to vitronectin is enhanced by the enzyme. The enzyme's proteolytic activity is required for optimal macrophage three-dimensional invasion through a matrix barrier
physiological function
urokinase-type plasminogen activator is a serine protease that is implicated as a key mediator of cellular invasion and tissue remodeling, the enzyme is thought to play a central role in tumor metastasis and angiogenesis
physiological function
-
urokinase-type plasminogen activator is a serine proteinase that plays a central role in tissue remodeling via binding to the urokinase plasminogen activator receptor and promotes dendritic spine recovery and improves neurological outcome following ischemic stroke. The enzyme does not have an effect on ischemia- or hypoxia-induced neuronal death. The excitotoxic injury induces the clustering of enzyme receptor in dendritic varicosities, and the binding of the enzyme and its receptor promotes the reorganization of the actin cytoskeleton and re-emergence of dendritic filopodia from enzyme receptor-enriched varicosities mediated by Rac-regulated profilin expression and cofilin phosphorylation
physiological function
role of the enzyme in pancreatic ductal adenocarcinoma cancer stem cells, a large fraction of these side population cells are CD44 and CD24 positive, are gemcitabine resistant, possess sphere-forming ability, and exhibit increased tumorigenicity. The enzyme interacts directly with transcription factors LIM homeobox-2 (Lhx2), homeobox transcription factor A5 (HOXA5), and Hey to possibly promote cancer stemness. The enzyme regulates Lhx2 expression by suppressing expression of miR-124 and p53 expression by repressing its promoter by inactivating HOXA5. Regulation of gene transcription by the enzyme contributes to cancer stemness and clinical lethality
physiological function
the enzyme plays an important role in the processes of tumor cell metastasis, aortic aneurysm, and multiple sclerosis
physiological function
-
urokinase plasminogen activator induces pro-fibrotic/m2 phenotype in murine cardiac macrophages, overview. The phenotype is adopted after migration of the macrophages to the heart. Elevation of the pro-inflammatory cytokine interleukin-6 in hearts of transgenic mice overexpressing the enzyme, interleukin-6 is not a major effector of the enzyme-induced cardiac fibrosis
physiological function
the enzyme is primarily involved in cell-associated plasminogen activation. Urokinase-type plasminogen activator contributes to plasmin recruitment and subsequent invasive disease initiation by invasive Group A streptococci in vivo, it hhas a key role in cell surface plasmin acquisition and bacterial dissemination in invasive Group A streptococcus disease
physiological function
activated extracellular enzyme cleaves plasminogen to plasmin, which initiates an extracellular protease cascade to degrade the extracellular matrix and facilitate cellular processes such as cellular migration, angiogenesis, tissue remodeling, and wound repair
physiological function
-
the enzyme modulates monocyte-to-macrophage differentiation and prevents oxidized LDL-induced macrophage apoptosis via ERK1/2 activation-dependent Bim downregulation, mechanism, overview. Monocyte-to-macrophage differentiation and macrophage death play a pivotal role in atherogenesis. The enzyme and its receptor uPAR are expressed in atherosclerotic lesion macrophages and contribute to atherosclerosis progression
physiological function
the enzyme modulates monocyte-to-macrophage differentiation and prevents oxidized LDL-induced macrophage apoptosis via ERK1/2 activation-dependent Bim downregulation, mechanism, overview. The enzyme attenuates MonoMac6 macrophage-like cell line apoptosis (with maximal inhibition of 51% by 5 nmol/l of enzyme) induced by oxidized LDL and by thapsigargin (inhibitor of sarcoendoplasmic reticulum Ca2þ-ATPase), but not by staurosporine (protein kinase inhibitor), suggesting that the enzyme's antiapoptotic activity is Ca2+-independent, but involves a kinase activation. Monocyte-to-macrophage differentiation and macrophage death play a pivotal role in atherogenesis. The enzyme and its receptor uPAR are expressed in atherosclerotic lesion macrophages and contribute to atherosclerosis progression. The enzyme attenuates endoplasmatic reticulum stress-induced cell death, overview
physiological function
the urokinase-type plasminogen activator regulates gene expression in the liver involving peroxisome-proliferator-activated receptor gamma's transcriptional activity and stimulates triglyceride synthesis in Huh-7 hepatoma cells via p38-dependent upregulation of diglyceride acyltransferase 2. Also, the amount of free fatty acids is highly up regulated by the enzyme through activation of the transcription factor SREBP-1., overview
physiological function
-
increasing concentrations of the enzyme dose-dependently decrease SR-BI protein expression in the liver and Huh-7 hepatoma cell line..The enzyme decreases both the cellular binding of HDL to Huh-7 hepatocytes, and the selective uptake of HDL-cholesteryl ester from HDL, it decreases the removal of HDL-cholesteryl ester in the liver via suppression of the hepatic SR-BI expression
physiological function
the enzyme mediates interleukin-17-induced peripheral blood mesenchymal stem cell motility and transendothelial migration without affecting matrix metalloproteinase expression, detailed overview. Interleukin-17 increases peripheral blood mesenchymal stem cell adhesion to endothelial cells and transendothelial migration, as well as increases the capacity of cell adhesion to fibronectin, in an urokinase-tyype plasminogen activator-dependent fashion
physiological function
urokinase-type PA (u-PA) and its single chain precursor (scu-PA) are mainly regarded as key factors in extravascular proteolysis. They have been shown to play an important role also in intravascular fibrin degradation. Enhancement of FSAP-mediated scu-PA activity by histones, overview
physiological function
transcriptional activation and regulation of urokinase plasminogen activator inducted by LPS through MyD88 independent pathway in rat Sertoli cells. uPA plays a role in the immune function of Sertoli cells in rat testis
physiological function
urokinase plasminogen activator mediates changes in human astrocytes modeling fragile X syndrome
physiological function
urokinase-type plasminogen activator (urokinase, uPA) is a serine protease that plays an important role in the fibrinolytic system by converting the inactive-form plasminogen into the catalytically active-form plasmin. Together with its receptor, urokinase-type plasminogen activator (uPA) plays an important role in tumorigenesis, tumor progression and metastasis. Binding of pro-uPA and HMW-uPA through the GFD to the glycolipid-anchored uPA receptor (uPAR) activates the conversion of plasminogen to plasmin on cell surfaces. Independently of proteolytic activity, the uPA-uPAR complex plays a key role in signal transduction by interacting with several adhesion molecules like integrins and vitronectin, cellular receptors and proteins of the extracellular matrix, to control cell proliferation, apoptosis, chemotaxis, adhesion and migration
physiological function
urokinase-type plasminogen activator (uPA) is a serine protease that cleaves plasminogen to yield the active protease plasmin. Tethering of uPA to the cell surface by the uPA receptor (uPAR) serves to promote such plasmin production. In addition to plasminogen, however, uPA targets other substrates. Such proteolysis mediated by uPA in the pericellular region regulates cell processes associated with tissue maintenance, remodeling, and repair. uPA also regulates the differentiation of corneal fibroblasts into myofibroblasts in vitro, with such differentiation having been found to occur in vivo during the healing of corneal stromal wounds. uPA negatively regulates alpha-smooth muscle actin expression via collagen receptor urokinase-type plasminogen activator (uPA) receptor-associated protein (uPARAP), termed Endo180, and the uPA receptor in corneal fibroblasts
physiological function
urokinase-type plasminogen activator (uPA) is a cell-secreted serine protease and plays a significant role in numerous biological processes. The enzyme plays an important role in extracellular matrix (ECM) degradation by hydrolyzing inactive plasminogen to active plasmin, which consequently activates uPA's downstream matrix metalloproteinases (MMPs)
physiological function
urokinase-type plasminogen activator (uPA) is a pro-metastatic trypsin-like serine protease that is upregulated in many aggressive solid malignancies. Coordinated expression of vascular endothelial growth factor A and urokinase-type plasminogen activator contributes to classical swine fever virus Shimen infection in macrophages
physiological function
A0A337S474
the binding of uPA to its receptor triggers the conversion of plasminogen into plasmin. The binding of uPA to its receptor triggers the conversion of plasminogen into plasmin, disintegrating the various components of the ECM and facilitating cell invasion, migration, and dissemination
physiological function
-
once generated from its zymogen, uPA, a member of the serine protease protein family, converts plasminogen into plasmin by binding to its receptor (uPAR) on the cell surface. Other than being instrumental in plasminogen activation, the uPA-uPAR binding also promotes the degradation of the extracellular matrix, a major event that underlies tumour progression and metastasis. uPA function in neuroreparation, overview
physiological function
the urokinase-type plasminogen activator (uPA) and plasmin cleave and activate each other, constituting a positive feedback loop
physiological function
pro-uPA zymogen has fibrinolytic activity, which is activated by fungi fibrinolytic compound 1 (FGFC1). pro-uPA and Glu-plasminogen mediate the fibrinolytic activity of FGFC1
physiological function
urokinase plasminogen activator (uPA) and its receptor uPAR promote cancer invasion and metastasis. High utilization of the uPA pathway and association with disease progression in canine osteosarcoma
physiological function
-
the plasminogen system plays a crucial role in the repair of a variety of tissues, including skeletal muscle. uPA promotes muscle regeneration by activating hepatocyte growth factor, which, in turn, stimulates proliferation of myoblasts required for regeneration. uPA promotes myoblast proliferation in vitro through its proteolytic activity
-
physiological function
-
urokinase-type plasminogen activator is involved in diverse physiologic and pathophysiologic processes, including fibrinolysis, cell migration and adhesion, and inflammation, thereby playing a role in efferocytosis. uPA inhibits the uptake of apoptotic neutrophils, suggest a novel mechanism by which elevated levels of uPA may participate in enhancing the duration and severity of inflammatory processes, such as acute lung injury. The phagocytosis of apoptotic neutrophils by macrophages is significantly inhibited by uPA, the process requires the kringle domain of uPA, and involves alphaVbeta3 integrin and vitronectin. But protease activity is not required for uPA to inhibit the engulfment of apoptotic neutrophils by macrophages, overview. Wild-type and inactive uPA are able to inhibit phagocytosis of apoptotic neutrophils by macrophages
-
physiological function
-
the urokinase plasminogen activator/uPA receptor/plasminogen system is involved in the development of atherosclerosis and aneurysms, modeling, overview
-
physiological function
-
urokinase plasminogen activator and its receptor coordinate a plasmin-mediated proteolytic cascade that is implicated in cell adhesion, cell motility, and matrix breakdown, for example, during inflammation. The enzyme is a central regulator of macrophage three-dimensional invasion, matrix degradation, and adhesion. Macrophage adhesion to vitronectin is enhanced by the enzyme. The enzyme's proteolytic activity is required for optimal macrophage three-dimensional invasion through a matrix barrier
-
physiological function
-
the enzyme modulates monocyte-to-macrophage differentiation and prevents oxidized LDL-induced macrophage apoptosis via ERK1/2 activation-dependent Bim downregulation, mechanism, overview. Monocyte-to-macrophage differentiation and macrophage death play a pivotal role in atherogenesis. The enzyme and its receptor uPAR are expressed in atherosclerotic lesion macrophages and contribute to atherosclerosis progression
-
physiological function
-
transcriptional activation and regulation of urokinase plasminogen activator inducted by LPS through MyD88 independent pathway in rat Sertoli cells. uPA plays a role in the immune function of Sertoli cells in rat testis
-
physiological function
-
urokinase-type plasminogen activator is a serine proteinase that plays a central role in tissue remodeling via binding to the urokinase plasminogen activator receptor and promotes dendritic spine recovery and improves neurological outcome following ischemic stroke. The enzyme does not have an effect on ischemia- or hypoxia-induced neuronal death. The excitotoxic injury induces the clustering of enzyme receptor in dendritic varicosities, and the binding of the enzyme and its receptor promotes the reorganization of the actin cytoskeleton and re-emergence of dendritic filopodia from enzyme receptor-enriched varicosities mediated by Rac-regulated profilin expression and cofilin phosphorylation
-
additional information

-
the expression and release of uPA is under active regulation in BV2 microglial cells
additional information
-
lipopolysaccharide promotes tumour cell ECM adhesion and invasion through activation of the u-PA system in a TLR-4- and NF-kappaB-dependent manner, overview
additional information
-
plasminogen activators are serine proteases that are classified as either urokinase-type PA, uPA, or tissue-type PA, tPA, based on their molecular mass
additional information
-
development of specific monoclonal antibodies against uPA able to detect the enzyme in tumor cell surfaces, overview
additional information
-
sphingosine kinase is necessary for basal activity of the uPA system and glioma cell invasion, while sphingosine 1-phosphate receptor signaling enhances invasion, partially through uPA and CCN1
additional information
-
uPAR is a key receptor involved in the formation of the serine protease plasmin by interacting with uPA and has been implicated in many physiological processes including proliferation and migration, determination of key regulatory regions and splice variants of UPAR, of multiple forms of uPAR, overview
additional information
-
urokinase plasminogen activator is elevated in pathological settings such as acute lung injury, where pulmonary arterial contractility and permeability are disrupted
additional information
-
concept of the protease web as the complex interplay between proteinases, their inhibitors and effector molecules, overview
additional information
-
chemotherapy prevents osteosarcoma cell invasion by down-regulation of urokinase plasminogen activity via up-regulation of transcription factor early growth response 1, EGR1, during chemotherapy period, overview
additional information
-
LasB, a thermolysin-like metalloprotease secreted by Pseudomonas aeruginosa, converts the human uPA zymogen into its active form, processes the uPA receptor, inactivates the plasminogen activator inhibitor 1, and activates pro-matrix metalloproteinase 2
additional information
-
there exists a direct link between conformational changes of the autolysis loop and the creation of a catalytically mature active site. The conformation-specific antibodies mAb-112 and mAb-12E6B10 are useful to selectively stain pro-uPA or active uPA on the surface of cultured cells
additional information
highly invasive cancers of breast, brain, prostate and lung notably have increased levels of the enzyme, its receptor uPAR, or an endogenous inhibitor protein PAI-1, which correlate with the propensity of a cancer cell type to invade and to disseminate
additional information
-
highly invasive cancers of breast, brain, prostate and lung notably have increased levels of the enzyme, its receptor uPAR, or an endogenous inhibitor protein PAI-1, which correlate with the propensity of a cancer cell type to invade and to disseminate
additional information
-
the enzyme's catalytic domain comprises residues 159-411
additional information
-
the catalytic activity of serine proteases depends on a salt-bridge between the amino group of residue 16 and the side chain of Asp194. The salt-bridge stabilizes the oxyanion hole and the S1 specificity pocket of the protease. Some serine proteases exist in only partially active forms, in which the amino group of residue 16 is exposed to the solvent. Such a partially active state is assumed by a truncated form of the murine urokinase-type plasminogen activator consisting of residues 16-243, allosteric interconversion analysis between partially active states and the fully active state, overview. Both a monoclonal antibody (mU3) and a peptidic inhibitor (mupain-1-16) stabilize the active state
additional information
-
the enzyme's catalytic domain comprises residues 159-411
additional information
although the interaction areas between protease-substrate and protease-inhibitor are shared, the two interactions are mechanistically different
additional information
-
although the interaction areas between protease-substrate and protease-inhibitor are shared, the two interactions are mechanistically different
additional information
interaction analysis of the urokinase plasminogen activator uPA with its receptor uPAR, using high resolution crystallographic data (PDB ID 2FD6) of the uPA-uPAR binding geometry to perform quantum biochemistry computations within the density functional theory (DFT) framework, overview. In order of importance, Phe25, Tyr24, Trp30, and Ile28 are the most relevant uPA residues binding to uPAR, residues Lys98, His87, Gln40, Asn22, Lys23 and Val20 also have significant interaction energies
additional information
histones differentially modulate clot lysis depending on the plasminogen activator. Histones favor FSAP autoactivation, which in turn enables scu-PA to express its full plasminogen activator potential. Concerning FSAP activation, the histone-DNA complex induces a delayed and reduces cleavage of the FSAP-sensitive substrate, compared to histones alone, whereas DNA is totally inactive. Enhancement of both FSAP activation and scu-PA fibrinolytic activity is also observed with a desulfated form of heparin
additional information
extracellular uPA levels correlate with intracellular Ca2+ responses in human astrocytes, hASTRO
additional information
the catalytic triad is formed by residues H204, D255, and S356
additional information
the lysine-binding sites (LBSs) play a crucial role in the process of FGFC1 binding to plasminogen. Action mechanism of FGFC1 binding to plasminogen, FGFC1 is able to induce plasminogen to exhibit an open conformation by binding through the LBSs, role of Glu-plasminogen in the fibrinolytic activity of FGFC1, molecular docking, overview
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
C122S
-
mutant of the serine proteinase domain
E301A
-
site-directed mutagenesis
E301D
-
site-directed mutagenesis
E301H
-
site-directed mutagenesis
H99Y/Q192K
-
site-directed mutagenesis, the mutations exchanges the human residues for the murine equivalents, rendering the mutant enzyme susceptible for inhibition by the murine peptide sequence mupain-1, overview
K300A
-
site-directed mutagenesis
K300H
-
site-directed mutagenesis
K300W
-
site-directed mutagenesis
K313A
-
site-directed mutagenesis
L97bG/H99Y/S195A/R217E
site-directed mutagenesis, the mutant shows altered interaction with human plasminogen activator inhibitor-1 compare to wild-type
L97bG/S195A
site-directed mutagenesis, the mutant shows altered interaction with human plasminogen activator inhibitor-1 compare to wild-type
L97bG/S195A/R217E
site-directed mutagenesis, the mutant shows altered interaction with human plasminogen activator inhibitor-1 compare to wild-type
P309A
-
60% increase in KM-value for L-pyroGlu-Gly-L-Arg-4-nitroanilide
P309D
-
200% increase in KM-value for L-pyroGlu-Gly-L-Arg-4-nitroanilide, about 15% decrease in activation by Lys-plasmin
P309F
-
500% increase in KM-value for L-pyroGlu-Gly-L-Arg-4-nitroanilide, about 15% decrease in activation by Lys-plasmin
P309G
-
100% increase in KM-value for L-pyroGlu-Gly-L-Arg-4-nitroanilide
P309H
-
400% increase in KM-value for L-pyroGlu-Gly-L-Arg-4-nitroanilide, about 15% decrease in activation by Lys-plasmin
P309L
-
250% increase in KM-value for L-pyroGlu-Gly-L-Arg-4-nitroanilide
P309N
-
150% increase in KM-value for L-pyroGlu-Gly-L-Arg-4-nitroanilide
P309R
-
350% increase in KM-value for L-pyroGlu-Gly-L-Arg-4-nitroanilide, about 15% decrease in activation by Lys-plasmin
P309S
-
50% increase in KM-value for L-pyroGlu-Gly-L-Arg-4-nitroanilide
P309T
-
60% increase in KM-value for L-pyroGlu-Gly-L-Arg-4-nitroanilide, about 15% decrease in activation by Lys-plasmin
P309V
-
80% increase in KM-value for L-pyroGlu-Gly-L-Arg-4-nitroanilide
P309W
-
700% increase in KM-value for L-pyroGlu-Gly-L-Arg-4-nitroanilide
R178A/R179A/R181A
-
site-directed mutagenesis, the mutant shows reduced receptor binding
R340A
-
site-directed mutagenesis, the binding of the mutant enzyme to maspin is not affected
S195A/C122S/N145D
-
inactive variant
S195A/R217E
site-directed mutagenesis, the mutant shows altered interaction with human plasminogen activator inhibitor-1 compare to wild-type
S303E
-
site-directed mutagenesis
S356A
-
a catalytically inactive uPA mutant
V41K/H99Y
-
site-directed mutagenesis, the mutations exchanges the human residues for the murine equivalents, rendering the mutant enzyme susceptible for inhibition by the murine peptide sequence mupain-1, overview
V41K/H99Y/Q192K
-
site-directed mutagenesis, the mutations exchanges the human residues for the murine equivalents, rendering the mutant enzyme susceptible for inhibition by the murine peptide sequence mupain-1, overview
Y306G
-
site-directed mutagenesis
E137A
-
site-directed mutagenesis, introduction of the mutations F40Y or E137A into muPA(16-243) increased exposure of the N-terminus (Ile16) and resulted in large changes in the thermodynamic parameters for mupain-1-16 binding
F40Y
-
site-directed mutagenesis, introduction of the mutations F40Y or E137A into muPA(16-243) increased exposure of the N-terminus (Ile16) and resulted in large changes in the thermodynamic parameters for mupain-1-16 binding
H99Y

-
site-directed mutagenesis, the mutation exchanges the human residue H99 for the murine equivalent Y99, rendering the mutant enzyme susceptible for inhibition by the murine peptide sequence mupain-1, overview
H99Y
-
site-directed mutagenesis, structure analysis with bound inhibitors
S195A

site-directed mutagenesis, the mutant contains the catalytically inactive form of the human uPA protease domain
S195A
-
site-directed mutagenesis, the active site mutant is not able to activate the epithelial sodium channel in contrast to the wild-type enzyme
S195A
site-directed mutagenesis, the mutant shows altered interaction with human plasminogen activator inhibitor-1 compare to wild-type
additional information

-
reduction of enzyme expression by 53% by stable transfection with antisense/vector construct and by 65% by siRNa transfection results in strong decrease of cellular proliferation activity. Exogenous addition of high-molecular-weight enzyme or enzyme N-terminal fragment lead to increased cell proliferation
additional information
-
deletion of the N-terminal growth factor domain of uPA reduced the affinity for enzyme receptors 2-4fold, depending on the receptor, e.g. VLDLR-I, SorLA, or LRP-1A, and deletion of both the growth factor domain and the kringle reduced the receptor affinity 7fold, overview
additional information
-
functional overexpression of the enzyme in hepatic stellate cells, using an adenoviral vector system, produces downregulation of pro-fibrogenic genes involved in liver fibrosis, and results in a highly specific decrease of TGF-beta expression, and at the same time of genes such as PAI-1, TIMP-1, and collagen type I, which respond to intracellular signals generated by TGF-beta and are involved in perpetuation of fibrogenesis, it also results in upregulation of MMP-3, MMP-2 and MMP-9 activities, overview
additional information
-
the isolated recombinant kringle domain UK1 of uPA shows in vivo antitumor effects in a brain tumor model, systemic administration of purified recombinant UK1 leads to suppression of the growth of a U87 human glioma xenograft, implanted into the brains of male BALB/cSlc nude mice, overview
additional information
-
use of uPA/SCID transgenic mice. Homozygous uPA/SCID mice have a small offspring. Female uPA/SCID mice display a deregulation of ovarian function with an absence of corpus luteum. In male uPA/SCID mice, a decrease of the weight of the testes, epididymis, seminal vesicle, and prostate is measured, associated with an absence of seminal and prostatic secretions and a reduction in testicular sperm production. Transplantation of hepatocytes from mice lacking the uPA transgene results in total repopulation of the livers of uPA/SCID mice and restoration of normal body weight, life span, and reproductive organ function
additional information
-
treatment with uPAR siRNA significantly increases the G0-G1 population by 27% in the CFPAC-1 cells and 20.4% in the PANC-1 cells, compared to control, PAI-2 or uPA siRNA, overview. uPA siRNA treatment reduces cell migration by approximately 25% for CFPAC-1 and 18% for PANC-1 cells. Transfection with PAI-2 siRNA has no effect on cell migration compared to non-silencing siRNA controls
additional information
-
transduction of blood monocyte-derived macrophages with uPA-containing adenovirus leads to uPA overexpression. Uptake of the cells into an induced thrombus in mouse leads to increased migration rate of the macrophages and MM6 cells in the thombus, overview. Systemic administration of uPA up-regulated human blood monocyte-derived macrophages reduces thrombus size in an experimental model of venous thrombosis. Adenovirus-uPA transduction increases blood monocyte-derived macrophages fibrinolytic activity by 150fold, and uPAR and PAI-1 production by 1.6fold, it also induces cytokine expression, overview
additional information
-
overexpression of the urokinase-type plasminogen activator N-terminal fragment, uPA ATF, inhibits the combination of uPA receptor and uPA competitively, and the cell invasive migration
additional information
-
generation of an uPA PAI-I docking-site mutant
additional information
-
expression of recombinant human uPA in enzyme-ablated mouse livers using adenoviral transfection
additional information
-
three truncation mutants of the N-terminal fragment of the enzyme still activate the epithelial sodium channel
additional information
generation of strain AlbPLG1/uPA-/- enzyme-deficient mice
additional information
-
generation of strain AlbPLG1/uPA-/- enzyme-deficient mice
additional information
analysis of interaction kinetics of the wild-type and mutant human enzymes with human and zebrafish plasminogen activator inhibitor-1 and of the zebrafish wild-type and mutant enzyme with both inhibitors, overview
additional information
-
analysis of interaction kinetics of the wild-type and mutant human enzymes with human and zebrafish plasminogen activator inhibitor-1 and of the zebrafish wild-type and mutant enzyme with both inhibitors, overview
additional information
-
clinical trials employing uPA as a thrombolytic agent show favourable outcomes and report consistent increases in recanalisation, functional improvement and cerebral haemorrhage rates, similar to those observed with recombinant tPA. Single-chain zymogen pro-urokinase (pro-uPA) and rtPA appear to be complementary and synergistic in their action, suggesting that their co-administration may improve the efficacy of thrombolysis without affecting the overall risk of haemorrhage. As plasmin-mediated conversion of pro-uPA to uPA negates its fibrin specificity, a single site mutant (M5) of native pro-uPA, resistant to conversion into uPA, has been designed
additional information
after STAT3 overexpression, a decrease of the migratory potential and uPA expression caused by morin in U2OS cells occurs
additional information
construction of a fibrinolytic system composed of plasminogen (PLG) and pro-uPA in vitro on the basis of previous studies to evaluate the fibrinolytic characterization of FGFC1 mediated by plasminogen and pro-uPA. The fibrinolytic system is used to investigate the binding sites and mode of binding between FGFC1 and plasminogen, thereby inferring the mechanism of their interaction, overview
additional information
-
compensatory skeletal muscle hypertrophy is abrogated in enzyme null mice, overview
additional information
-
enzyme-deficient mice show decreased accumulation of macrophages following muscle injury and severely impaired muscle regeneration, overview
additional information
-
mice deficient for uPA activity fail to induce uPA receptor expression after lipopolysaccharide treatment. In these mice, lipopolysaccharide treatment fails to alter the binding of phosphoglycerate kinase and heterogenous nuclear ribonucleoprotein C with uPA receptor mRNA due to lack of tyrosine phophorylation
additional information
-
mice deficient in uPA show markedly reduced hepatocyte growth factor levels and c-met activation after muscle damage, associated with decreased cell proliferation, myoblast accumulation, and new muscle fiber formation, phenotype, overview. On the other hand, hepatocyte growth factor activity is enhanced at early time points in enzyme inhibitor-deficient PAI-1-/- mice compared with wild-type mice, and the PAI-1-/- animals exhibit accelerated muscle fiber regeneration. Administration of exogenous uPA rescues hepatocyte growth factor levels and muscle regeneration in uPA-/- mice
additional information
-
the distorted state of truncated mutant muPA(16-243) is conformationally ordered upon binding of ligands to the active site and upon binding of mU3 to the 37- and 70-loop
additional information
-
at any age, both uPA and uPAR are significantly lower in rd10 mice with respect to wild-type mice. In particular, at PD10, PD15 and PD30, uPA levels in rd10 mice are approximately 1.5, 1.6 and 2.1fold lower than in wild-type mice, while uPAR levels are approximately 1.5, 1.7 and 2.3fold lower, respectively. In models of ocular pathologies characterized by HIF-1 up-regulation, uPAR is overexpressed in response to ischaemic conditions. In tumour angiogenesis, HIF-1 mediates the transcription of uPA/uPAR genes during hypoxia. In this respect, mouse models of retinal degeneration as the rd10 model are characterized by low levels of HIF-1, preventing the degradation of HIF-1alpha, the oxygen-sensitive subunit of HIF-1, might recover retinal levels of uPA/uPAR
additional information
generation of enzyme-deficient uPA-/- mice
additional information
-
compensatory skeletal muscle hypertrophy is abrogated in enzyme null mice, overview
-
additional information
-
enzyme-deficient mice show decreased accumulation of macrophages following muscle injury and severely impaired muscle regeneration, overview
-
additional information
-
mice deficient in uPA show markedly reduced hepatocyte growth factor levels and c-met activation after muscle damage, associated with decreased cell proliferation, myoblast accumulation, and new muscle fiber formation, phenotype, overview. On the other hand, hepatocyte growth factor activity is enhanced at early time points in enzyme inhibitor-deficient PAI-1-/- mice compared with wild-type mice, and the PAI-1-/- animals exhibit accelerated muscle fiber regeneration. Administration of exogenous uPA rescues hepatocyte growth factor levels and muscle regeneration in uPA-/- mice
-
additional information
-
at any age, both uPA and uPAR are significantly lower in rd10 mice with respect to wild-type mice. In particular, at PD10, PD15 and PD30, uPA levels in rd10 mice are approximately 1.5, 1.6 and 2.1fold lower than in wild-type mice, while uPAR levels are approximately 1.5, 1.7 and 2.3fold lower, respectively. In models of ocular pathologies characterized by HIF-1 up-regulation, uPAR is overexpressed in response to ischaemic conditions. In tumour angiogenesis, HIF-1 mediates the transcription of uPA/uPAR genes during hypoxia. In this respect, mouse models of retinal degeneration as the rd10 model are characterized by low levels of HIF-1, preventing the degradation of HIF-1alpha, the oxygen-sensitive subunit of HIF-1, might recover retinal levels of uPA/uPAR
-
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
agriculture
-
effect of urokinase-type plasminogen activator on in vitro embryo production. Urokinase-type plasminogen activator added to the 18 h in vitro maturation medium significantly increases embryo development rates
analysis

-
optical zymography technique that specifically detects enzyme activity in biological samples via fluorescence emission at 695 nm. Method can efficiently distinguish the active two-chain enzyme from its proenzyme and directly measure enzyme activities in different cancer cell lines
analysis
-
assay of cellular internalization and localization of enzyme:PAI-2 inhibitor complex based on the use of inhibitor labelled with Alexa488 fluorochrome and a polyclonal antibody
analysis
-
quantification of uPA and inhibitor PAI-1 mRNA expression in breast cancer cell lines as well as in tumor tissue of breast cancer patients by sensitive quantitative real-time PCR assays, based on the LightCycler technology. In breast cancer cell lines, mRNA and antigen values are highly correlated for both uPA and PAI-1 I. Correlations between uPA/PAI-1 mRNA and protein in the breast cancer samples were found to be distinctly weaker or not significant. Quantitative determination of mRNA expression for both factors does not mirror antigen levels in breast cancer tissue
diagnostics

-
uPA is the strongest single indicator of poor prognosis in patients with metastatic breast cancer
diagnostics
-
urokinase-type plasminogen activator is a marker of aggressive phenotype and an independent prognostic factor in mismatch repair-proficient colorectal cancer, overview
diagnostics
-
expression level of uPA in prostate cancer tissue can be used as a predictor of biochemical recurrence in patients undergoing radical prostatectomy, i.e. strong expression of uPA in addition to a Gleason score, positive surgical margin, and lymph node metastasis
diagnostics
urokinase-type plasminogen activator is a potential marker for cancer prognosis and diagnosis
diagnostics
prognostic significance of the urokinase plasminogen activator system in tissue and serum of dogs with appendicular osteosarcoma. Design of a bioluminescence (BL) probe, Gly-Gly-Arg-D-aminoluciferin (GGR-AmLuc), to detect uPA in vitro and sense uPA both inside cells and in tumors for highly sensitive diagnosis of cancers overexpressing uPA. GGRAmLuc is successfully applied to image uPA in living subjects with excellent sensitivity. GGR-AmLuc is able to selectively detect uPA with a limit of detection (LOD) of 0.00137 mg/l. probe GGR-AmLuc can be applied for highly sensitive diagnosis of cancers
diagnostics
A0A337S474
potential value of uPA as a cancer biomarker. The average serum concentration of uPA in cancerous cats differs from that of healthy cats but is not significantly influenced by cats' clinicopathological parameters or by the presence of metastases, relevance of uPAS in feline carcinogenesis
diagnostics
analysis of statistics shows the prognostic significance of the urokinase plasminogen activator system in tissue and serum of dogs with appendicular osteosarcoma. In Cox multivariate analysis, high serum uPA level and activity are both associated with poor prognosis, independent of serum ALP, tumor location, and peripheral lymphocyte/monocyte counts. The uPA system is a potential therapeutic target in canine osteosarcoma
drug development

-
the enzyme is an attractive target for the development of small molecule active site inhibitors
drug development
-
uPA is a potential therapeutic target in a variety of pathological conditions, including cancer
drug development
-
complex formation of uPA and uPAR is a target for development of therapeutics
drug development
urokinase-type plasminogen activator is a target for cancer therapies. Highly specific DNA aptamers showing small size, together with a polyanionic nature, which results in good tissue penetration and rapid blood clearance, may be promising agents for therapeutics, while showing no immunoreactivity and low-to-no toxicity, potential inhibition of both the functionally important interactions of uPA with its receptor and the catalytic activity of uPA in different types of cancer, overview
medicine

-
associated with tumor metastasis and invasion, selective inhibitors of uPA may have potential as therapeutically useful drugs for prostate, breast and other cancers
medicine
-
after infection with staphylococci, level of metabolically active enzyme is unaltered in plasma but significantly decreased in kidney homogenate. Enzyme acts as endogenous antibacterial substance. Decrease in enzyme level in infected organs may be due to dramatically increased production of plasminogen activator inhibitor type I
medicine
treatment of cancer with small-molecule active-site inhibitors with a C-terminal 4-amindinobenzylamide residue to prevent metastasis. Inhibitor dose of 2 x 1.5 mg/kg/day of inhibitor N-(benzylsulfonyl)-D-seryl-N-(4-carbamimidoylbenzyl)-L-serinamide reduces number of metastases to 4.6% in mice
medicine
-
active enzyme promotes tumor progression, activation of enzyme appears as a key step in tumor progression. Inhibition of enzyme with natural or synthetic inhibitors diminishes high intravasating Matrigel invasion in vitro and intravasation and metastasis in vivo
medicine
-
amino-terminal fragment ATF of urokinase exerts an antitumor effect via dual mechanisms: essentially through targeting the uPA-uPAR system via the EGF-like domain and partially through targeting a uPAR-indepedent interaction via the kringle domain
medicine
-
amino-terminal fragment ATF of urokinase exerts an antitumor effect via dual mechanisms: essentially through targeting the uPA-uPAR system via the EGF-like domain and partially through targeting a uPAR-indepedent interaction via the kringle domain
medicine
-
in sputum derived from patients with house dust mite allergic asthma, the medium concentration of uPA is significantly greater than in healthy control patients. The sputum concentration of uPA correlates with sputum total cell count and with logarithmically transformed exhaled nitric oxide concentration, but not with FEV1 or bronchial reactivity to histamine. Tge effect of uPA seems to be independent of its fibrinolytic activity
medicine
-
quantification of uPA and inhibitor PAI-1 mRNA expression in breast cancer cell lines as well as in tumor tissue of breast cancer patients by sensitive quantitative real-time PCR assays, based on the LightCycler technology. In breast cancer cell lines, mRNA and antigen values are highly correlated for both uPA and PAI-1 I. Correlations between uPA/PAI-1 mRNA and protein in the breast cancer samples were found to be distinctly weaker or not significant. Quantitative determination of mRNA expression for both factors does not mirror antigen levels in breast cancer tissue
medicine
-
in mice model for kidney ischemia reperfusion injury, deficiency for uPA receptor, but not uPA protects from ischemia reperfusion injury. In the allogenic kidney transplant model, uPA receptor but not uPA deficiency of the allograft causes superior recipient survival and strongly attenuates loss of renal function. uPA receptor-deficient allografts show reduced generation of reactive oxygen species and apoptosis. Neutrophil and monocyte/macrophage infiltration is strongly attenuated and up-regulation of the adhesion molecule ICAM-1 is completely abrogated in uPA receptor-deficient allografts
medicine
-
induction of lateral fluid percussion brain injury results in up-regulation of uPA and ERK mitogen-activated protein kinase. uPA contributes to the impairment of sodium nitroprusside and PGE2-mediated cerebrovasodilatation through activation of low-density lipoprotein receptor and ERK mitogen-activated protein kinase
medicine
-
uPA promotes inward arterial remodeling by regulating oxidative stress and inflammation after arterial injury
medicine
-
in a severe combined immunodeficient-human mouse model, PC-3 cells are the major source of uPA in the experimental bone tumor. Injection of uPA-silenced PC-3 cells in bone xenografts results in significant reduction of bone tumor burdens and protection of trabecular bones from destruction. The suppressed tumor growth is associated with the level of uPA expression but not with its activity. An increase in the expression of PAI-1, the endogenous uPA inhibitor, is found during in vitro tumor-stromal interactions. Up-regulation of PAI-1 in bone stromal cells and preosteoclasts/osteoblasts is due to soluble factor(s) released by PC cells, and the enhanced PAI-1 expression in turn stimulated PC cell migration
medicine
-
brain tissue of thermally injured rats displays an increase in the brain water content and the presence of Evans blue, temporally associated with an increased expression of endogenous tPA and uPA. Peripheral thermal injury does induce an increase in the permeability of the blood brain barrier
medicine
-
uPA, seprase and pipeptidylaminopeptidase IV immunoreactivity is found in dysplastic and cancer cells as well as in stromal cells adjacent to dysplasia and cancer sites, but not in normal epithelium. There is a significant association between uPA expression and sex, tumor size and histological classification in carcinomas. Squamous cell carcinoma lines display higher levels of uPA, seprase and dipeptidylaminopeptidase IV than normal esophageal epithelial cell lines
medicine
-
in cancer cell, expression of uPA and uPA receptor underlies a mechanism of stem cell tropism to malignant tumors
medicine
-
the levels of uPA and uPA receptor in patients with acute or chronic hepatitis B significantly exceeds those in healthy controls. Patients with severe chronic hepatitis B have significantly higher levels of uPA and uPA receptor than those with moderate and mild chronic disease and those with acute hepatitis B. The plasma uPA and uPA receptor levels markedly increase in the acute stage and dramatically decrease in the remission stage, but in all stages levels exceede those in healthy subjects. The concentration of plasma uPA receptor is positively correlated with prothrombin and total bilirubin
medicine
-
expression of uPA, its receptor, and of inhibitor PAI-1 is increased in response to Helicobacter pylori, and for uPA, but not the receptor or PAI-1, requires the virulence factor CagE. Helicobacter pylori also stimulates soluble and cell surface-bound uPA activity. It stimulates epithelial cell proliferation, which is inhibited by uPA immunoneutralization and uPA receptor knock-down. Expogenous uPA also stimulates proliferation that is further increased after PAI-1 knock-down
medicine
-
in patients with colorectal cancer, the protease antigen levels are significantly higher compared with other groups. At the time of clinical detection proteases cathepsin B, cathepsin L and urokinase-type plasminogen activator and its inhibitor are more sensitive indicators for colorectal cancer than commonly used tumor markers. Determination of cathepsin B, cathepsin L and urokinase-type plasminogen activator and its inhibitor have a major prognostic impact in patients with colorectal cancer
medicine
-
study on cocaine-induced conditioned-place preference in rats with bilateral intra-accumbens injections of uPA-expressing lentiviral vectors. Overexpression of uPA in the nucleus accumbens significantly augments cocaine-induced place preference. Reinstatement with a low dose of cocaine produces significantly greater preference to the cocaine-associated context. Once cocaine-induced conditioned-place preference has been established, and the preference extinguished, reinstatement induced by a priming dose of cocaine is facilitated by uPA. Inhibition of tuPA expression abolishes the augmented acquisition produced by overexpression of uPA but not the expression of the cocaine-induced conditioned-place preference. When uPA is inhibited during the acquisition phase, animals no longer demonstrate place preference for the environment previously paired with cocaine. B428, a specific uPA inhibitor does not affect drug reinstatement after extinction if uPA has been activated during acquisition. Cocaine-induced conditioned-place preference and reinstatement may be dependent on active extracellular uPA
medicine
-
possible involvement of uPA in natural killer cell-mediated immune surveillance and tumor escape. Addition of uPA to natural killer cell receptor Ly49E positive adult and fetal natural killer cells inhibits interferon-gamma secretion and reduces their cytotoxic potential, respectively
medicine
-
either uPA/uPAR interaction, Mac-1 activation, or prevention of its association with uPAR triggers a signaling pathway leading to the inefficient release of HIV from monocytic cells
medicine
-
the overexpression of uPA in Quebec platelet disease emerges with megakaryocyte differentiation, without altering the expression of flanking genes. uPA is costored with-granule proteins prior to their proteolysis in Quebec platelet disease
medicine
-
silencing of transmembrane protein Notch1 expression by siRNa inhibits invasion of human prostate cancer cells by inhibiting the expression of matrix metalloproteinase-9 and uPA
medicine
-
all patients examined with common variable immunodeficiency had increased plasma levels of soluble uPA receptor with particularly high levels in those with splenomegaly and thrombocytopenia. Plasma uPA levels were also raised in these patients, and both soluble uPA receptor and uPA levels correlated with the monocyte activation marker neopterin. Monocytes from patients with common variable immunodeficiency had increased expression of uPA receptor
medicine
-
macrophages, recruited into venous thrombi, can be used to target uPA gene constructs to the thrombus after systemic administration
medicine
-
co-operation between TIMP-1 and host uPA suggests that therapies, simultaneously interfering with pro- and anti-proteolytic pathways may be beneficial for patients with metastatic disease
medicine
-
co-operation between TIMP-1 and host uPA suggests that therapies, simultaneously interfering with pro- and anti-proteolytic pathways may be beneficial for patients with metastatic disease
medicine
inhibition of the enzyme might be beneficial in treating cancer
medicine
-
stroke continues to be one of the leading causes of mortality and morbidity worldwide. Restoration of cerebral blood flow by recombinant tissue plasminogen activator (rtPA) with or without mechanical thrombectomy is considered the most effective therapy for rescuing brain tissue from ischaemic damage. Thrombolysis with uPA appears to be a potential alternative to rtPA-mediated reperfusive treatment due to its beneficial effects on the promotion of revascularisation and nerve regeneration. Single-chain zymogen pro-urokinase (pro-uPA) and rtPA are complementary and synergistic in their action
medicine
enzyme suppressor morin may be a potential candidate for the antimetastatic treatment of human osteosarcoma
pharmacology

-
rapid, sensitive and selective method for detection of uPA activator UK-356202 in human plasma using column-switching HPLC and fluorescence detection. The limit of detection is 20 pg/ml, and the method is linear over a 100-fold concentration range
pharmacology
-
Treatment of nude mice bearing subcutaneously or orthotopically implanted human colon cancer cell lines HCT-116 and HT-29 with TX-1877, irradiation or TX-1877 with irradiation results in significant inhibition of matrix metalloproteinase-9 and uPA. Treatments also inhibit the para-aortic lymph node metastasis, however, do not prolong the survival in orthotopic model. In the subcutaneous model, tumors treated with TX-1877 and irradiation show significant reductions in volume
pharmacology
-
uPA blocking antibodies may not be indicated for cancer growth inhibition strategies, but may serve as valuable tools for the implementation of pharmacodelivery strategies against a variety of different tumors