Literature summary for 6.5.1.2 extracted from

Doi, A.; Pack, S.P.; Makino, K.
Comparison of the molecular influences of NO-induced lesions in DNA strands on the reactivity of polynucleotide kinases, DNA ligases and DNA polymerases (2010), J. Biochem., 147, 697-703.

Search for more literature for 6.5.1.2

Organism

Organism	UniProt	Comment	Textmining
Tequatrovirus T4	-	-	-
Thermus aquaticus	-	-	-

Substrates and Products (Substrate)

Substrates	Comment Substrates	Organism	Products	Comment (Products)	Rev.	Reac.
NAD+ + (deoxyribonucleotide)n + (deoxyribonucleotide)m	-	Thermus aquaticus	AMP + beta-nicotinamide D-ribonucleotide + (deoxyribonucleotide)n+m	-	?
NAD+ + (deoxyribonucleotide)n + (deoxyribonucleotide)m	-	Tequatrovirus T4	AMP + beta-nicotinamide D-ribonucleotide + (deoxyribonucleotide)n+m	-	?
NAD+ + 5'-d(ACCATTCCTGATTCTAAGTG)-3' + 5'-d(CTCAGGTCGACAGTCTGCGG)-3'	100% ligation efficiency	Thermus aquaticus	?	-	?
NAD+ + 5'-d(ACCATTCCTGATTCTAAGTG)-3' + 5'-d(CTCAGGTCGACAGTCTGCGG)-3'	100% ligation efficiency	Tequatrovirus T4	?	-	?
NAD+ + 5'-d(GCCATTCCTGATTCTAAGTG)-3' + 5'-d(CTCAGGTCGACAGTCTGCGG)-3'	100% ligation efficiency	Thermus aquaticus	?	-	?
NAD+ + 5'-d(GCCATTCCTGATTCTAAGTG)-3' + 5'-d(CTCAGGTCGACAGTCTGCGG)-3'	100% ligation efficiency	Tequatrovirus T4	?	-	?

Synonyms

Synonyms	Comment	Organism
T4 DNA ligase	-	Tequatrovirus T4
Taq DNA ligase	-	Thermus aquaticus

Cofactor

Cofactor	Comment	Organism	Structure
NAD+	-	Thermus aquaticus
NAD+	-	Tequatrovirus T4

Use of this online version of BRENDA is free under the CC BY 4.0 license. See terms of use for full details.

Release 2023.1 (January 2023)